Hi, I need to view the multiple Genbank submissions in Sequin. I
plan to use Batch Entrez to retrieve ~100 submissions. I'd like to
retain all the original annotations that are in the submissions. How
can I import all these into Sequin? I've done batch submissions but we
then annotate in Sequin and then submit. I've never done the reverse
successfully. If I load the file with a 100 different submissions,
Sequin opens up a 100 different windows. I just want the one window
where I can scroll down the list of accession numbers from entry to
entry. I can write a script if I need to reformat it for Sequin, but
I'm not sure what format it should be in.
Thanks, Paul
--
Paul Shinn pshinn at neomorph.salk.edu
SIGnAL http://signal.salk.edu
Sequencing Coordinator http://genome.salk.edu
(858) 453-4100 ext 1796
- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb
- GenBank on the WWW, see: http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca
