Greetings GenBank Users,
GenBank Release 131.0 is now available via ftp from the National Center
for Biotechnology Information (NCBI):
Ftp Site Directory Contents
---------------- --------- ---------------------------------------
ftp.ncbi.nih.gov genbank GenBank Release 131.0 flatfiles
ncbi-asn1 ASN.1 data used to create Release 131.0
Uncompressed, the Release 131.0 flatfiles require roughly 74.82 GB
(sequence files only) or 83.65 GB (including the 'short directory' and
'index' files). The ASN.1 version requires roughly 65.92 GB. From the
release notes:
Release Date Base Pairs Entries
130 Jun 2002 20648748345 17471130
131 Aug 2002 22616937182 18197119
Close-of-data was 08/23/2002. Six working days were required to prepare
this release. In the nine-week period between close-of-data for GenBank
releases 130.0 and 131.0, GenBank grew by 1.968 billion basepairs and by
725,989 sequence records. During that same period, 221,216 records were
updated. Combined, this yields an average of about 14,800 new/updated
records per day.
We would like to remind our users that GenBank mirrors are available
at ftp://genbank.sdsc.edu/pub and ftp://bio-mirror.net/biomirror/genbank .
Those who experience slow FTP transfers of large files (entire releases, the
GenBank Cumulative Update, etc) might realize an improvement in transfer
rates from these alternate sites when traffic at the NCBI is heavy.
For additional release information, see the README files in either of the
directories mentioned above, and the release notes (gbrel.txt) in the
genbank directory. Sections 1.3 and 1.4 of the release notes (Changes in
Release 131.0 and Upcoming Changes) have been appended below.
Release 131.0 data, and subsequent updates, are available now via NCBI's
Entrez and Blast services.
New GenBank cumulative update files (gbcu.flat.Z and gbcu.aso.Z), containing
only those entries new/updated since the Release 131.0 close-of-data, should be
available by 10:00am EDT, August 31. Please note that the new CUs will be
smaller than previous versions you might have obtained after Release 130.0 was
posted.
If you encounter problems while ftp'ing or uncompressing Release 131.0,
please send email outlining your difficulties to info at ncbi.nlm.nih.gov .
Mark Cavanaugh, Vladimir Alekseyev, Anton Butanaev
GenBank
NCBI/NLM/NIH
1.3 Important Changes in Release 131.0
1.3.1 Organizational changes
Due to database growth, the EST division is now being split into 178 pieces.
Due to database growth, the GSS division is now being split into 52 pieces.
Due to database growth, the HTG division is now being split into 43 pieces.
Due to database growth, the PRI division is now being split into 22 pieces.
Due to database growth, the ROD division is now being split into 4 pieces.
1.3.2 GSS File Header Problem
GSS sequences at GenBank are maintained in one of two different systems,
depending on their origin. One recent change to release processing involves
the parallelization of the dumps from those systems. Because the second dump
(for example) has no prior knowledge of exactly how many GSS files will be
dumped from the first, it doesn't know how to number it's own output files.
There is thus a discrepancy between the filenames and file headers of eight
GSS flatfiles in Release 131.0. Consider the gbgss45.seq file:
GBGSS1.SEQ Genetic Sequence Data Bank
August 15 2002
NCBI-GenBank Flat File Release 131.0
GSS Sequences (Part 1)
Here, the filename and part number in the header is "1", though the file
has been renamed as "45" based on the files dumped from the other system.
We will work to resolve this discrepancy in future releases, but the priority
is admittedly much lower than many other tasks.
1.3.3 Selenocysteine representation
At the May 1999 DDBJ/EMBL/GenBank collaborative meeting, it was learned
that IUPAC plans to adopt the letter 'U' for selenocysteine.
With this August 2002 release, selenocysteine residues are now presented
via residue abbreviation 'U', in both /translation and /transl_except
qualifiers.
1.4 Upcoming Changes
1.4.1 Change to the SOURCE and ORGANISM format
The GenBank flatfile format utilizes two different formats for the SOURCE
linetype, depending on the existence of a designated common name in the
GenBank Taxonomy Database -
--- Current GenBank format ---
SOURCE [organism name] OR [common name]
ORGANISM [organelle prefix] organism name
Starting with GenBank release 132.0 in October 2002, a new more flexible
SOURCE format will be adopted, allowing for the display of several types
of secondary names (common names, acronyms, synonyms, anamorphs for the fungi)
which can be derived either from the taxonomy database *or* from the source
feature annotation provided by the submitter.
In addition, the optional organelle prefix will move from the ORGANISM line
(in the old format) to the SOURCE line in the new format. The ORGANISM line
will contain only the unadorned organism name, the name by which a sequence
entry is indexed in the taxonomy database.
--- NEW GenBank format ---
SOURCE [organelle prefix] organism name ([optional second name])
ORGANISM organism name
The optional second name can be one of the following (ordered by precedence) -
'synonym' from the source feature organism modifiers (submitter-supplied)
'acronym' from the source feature organism modifiers (submitter-supplied)
'anamorph' from the source feature organism modifiers (submitter-supplied)
'common' from the source feature organism modifiers (submitter-supplied)
'genbank synonym' from the taxonomy database
'genbank acronmym' from the taxonomy database
'genbank anamorph' from the taxonomy database
'genbank common name' from the taxonomy database
The first set allows us to customize the flatfiles of particular entries,
the last allow us to add useful & informative information from the
taxonomy database (with a more reasonable presentation than in the
current flatfiles).
The 'anamorph' names will appear within parentheses prefixed with
(anamorph: ---). The 'common name', 'acronym' and 'synonym' fields will be
parenthesized without a prefix (see examples below).
The SOURCE line organelle prefix will correspond to the most detailed portion
of the string value for the /organelle qualifier of the source feature. This
allows us to annotate everything with the correct general terms, yet prominently
display the familiar 'Chloroplast' & 'Kinetoplast' :
organelle qualifer SOURCE organelle prefix
----------------- -----------------------
"plastid" plastid
"mitochondrion" mitochondrion
"nucleomorph" nucleomorph
"mitochondrion: kinetoplast" kinetoplast
"plastid: chloroplast" chloroplast
"plastid: apicoplast" apicoplast
"plastid: chromoplast" chromoplast
"plastid: cyanelle" cyanelle
"plastid: leucoplast" leucoplast
"plastid: protoplast" protoplast
=======================================================
====== Examples of the new format ======
=======================================================
In all of the examples below, the source feature qualifiers given
in the first part of the example will automatically generate the
SOURCE & ORGANISM lines shown:
------------------------
/organism="Sus scrofa"
SOURCE Sus scrofa (pig)
ORGANISM Sus scrofa
'pig' is the genbank common name from the GenBank taxonomy database.
------------------------
/organism="Sus scrofa"
/note="common: Japanese wild boar"
SOURCE Sus scrofa (Japanese wild boar)
ORGANISM Sus scrofa
The common name from the source feature (submittor-suppllied) for
the entry overrides the common name from the GenBank taxonomy database
with the new SOURCE format.
------------------------
/organism="Takifugu rubripes"
SOURCE Takifugu rubripes (Fugu rubripes)
ORGANISM Takifugu rubripes
'genbank synonym' from the taxonomy database is displayed on the SOURCE
line.
------------------------
/organism="Takifugu rubripes"
/note="common: Sydney's pufferfish"
SOURCE Takifugu rubripes (Sydney's pufferfish)
ORGANISM Takifugu rubripes
Any of the customizing fields from the entry itself take precedence
over the default values from the taxonomy database.
------------------------
/organism="Cauliflower mosaic virus"
SOURCE Cauliflower mosaic virus (CaMV)
ORGANISM Cauliflower mosaic virus
If there is a single acronym listed in the taxonomy database,
it will appear on the SOURCE line.
------------------------
'genbank anamorph' (from the taxonomy database)
/organism="Emericella nidulans"
SOURCE Emericella nidulans (anamorph: Aspergillus nidulans)
ORGANISM Emericella nidulans
The 'anamorph' nametype is prefixed with "anamorph:" on the SOURCE line
to distinguish it from a taxonomic synonym.
------------------------
/organism="Mytilus californicus"
/organelle="mitochondrion"
SOURCE mitochondrion Mytilus californicus (California mussel)
ORGANISM Mytilus californicus
Organelle prefix moved to SOURCE, with common name from the
GenBank taxonomy database.
Additional information about this change will be presented via the
GenBank release notes, and via the GenBank newsgroup.
---
- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb
- GenBank on the WWW, see: http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca
