IUBio

CDS sequences needed

pedrobeltrao pedrobeltrao at mail.pt
Fri May 10 16:08:06 EST 2002


"Huaichun Wang" <hcwang at science.uottawa.ca> wrote in message
news:abgrk1$emt$1 at mercury.hgmp.mrc.ac.uk...
> I have a list of 5126 protein sequences with SwissProt ID or accession
> number that I want to get the corresponding coding sequences from
> Genbank, EMBL or other databases.
>(...) Is there a way to do this extraction of gene (CDS)
> sequence according to swissprot IDs automatically?
> Huaichun Wang

Hi,

I guess the easiest way I see is to use PERL with BioPerl to go trough the
list and retrieve it. It takes a bit of time to set everything up and a bit
of practice with PERL but it makes tasks like that very simple.





- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/       
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb      
- GenBank on the WWW, see:  http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca                  





More information about the Genbankb mailing list

Send comments to us at biosci-help [At] net.bio.net