Francis Clark wrote:
> Are any of the "mRNA" sequences in GenBank predicted, and if so
> what is the best approach to identifying them?
Hello Francis,
If it says "mRNA" on the LOCUS line (the first line on the
record) it means an mRNA molecule was sequenced to generate
the sequence in that record. DDBJ/EMBL/GenBank do not accept
artificial, or predicted sequences. *BUT* there may be a
computer generated mRNA feature on a genomic sequence (it
would say "DNA" on the locus line ... I include two examples
below.
an mRNA sequence:
LOCUS PIGFICOLB 1042 bp mRNA linear MAM 07-FEB-2000
DEFINITION Sus scrofa ficolin mRNA, complete cds.
ACCESSION L12345
A genomic (DNA) sequence with an mRNA feature in the record:
LOCUS AJ639843 961 bp DNA linear PRI 18-APR-2005
DEFINITION Homo sapiens partial KIR3DP1 gene for killer cell
immunoglobulin-like receptor, allele KIR3DP1*004, exon 1.
ACCESSION AJ639843
VERSION AJ639843.1 GI:62550762
[deleted part of the record]
mRNA 685..718
/gene="KIR3DP1"
/allele="KIR3DP1*004"
Hope this helps.
cheers,
f.
--
BF Francis Ouellette http://bioinformatics.ubc.ca/ouellette
Francis Clark wrote:
> Hello,
>> I collect up mRNA sequences from the main GenBank flat files (for
> example, the gbpri*.seq files) in order to add to collections of
> transcripts derived from the est and htc files.
>> I've been trying to work out if any of these "mRNA" sequences are
> predicted, rather than being bona fide (possibly partial) mRNAs
> that someone somewhere has sequenced. I mean predicted in the
> sense of being a predicted splicing of sequenced DNA. I have
> previously encountered a similar sort of problem, where,
> apparently, mRNA sequences have been annotated as DNA. In any
> case:
>> Are any of the "mRNA" sequences in GenBank predicted, and if so
> what is the best approach to identifying them?
>> Any help with this will be greatly appreciated,
>>> Francis
>> --
> Francis Clark, PhD
> Research Fellow,
> Advanced Computational Modelling Centre, and
> ARC Centre in Bioinformatics,
> University of Queensland,
> Australia.
---
- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb
- GenBank on the WWW, see: http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at bioinformatics.ubc.ca
