GUS and GFP primers

Sarah Grant sgrant at email.unc.edu
Fri Jul 2 11:48:09 EST 1999


Dear Arabinetters,

I recently asked for information about primers and PCR conditions for
amplifying the uidA (GUS) gene or the GFP gene from transgenic Arabidopsis
DNA. I am posting the responses in case anyone else needs similar primers.
My thanks to those who answered!
Sarah Grant

From: Manuel Sainz <sainz at nature.berkeley.edu>
Subject: Re: GUS and GFP primers

Hi Sarah:

Allan Shapiro, a previous postdoc in the lab, developed primers for GUS
transgene amplification:

GUS-f  5' CAACGTCTGCTATCAGCGCGAAGT 3'
GUS-r  5' TATCCGGTTCGTTGGCAATACTCC 3'

Although I think one of them has a mismatch, I have successfully used these
in standard 50 uL PCR reactions:

50 mM KCl
10 mM Tris HCl pH 8.3
2 mM MgCl2
0.25 mM each dNTP
1 uL Taq
3% DMSO
50-100 ng genomic DNA
250 ng each primer
overlaid with mineral oil

running this program on an MJR machine:

4.5' 95C
30 cycles of -
  95C 45"
  55C 45"
  72C 3'
7' 72C
hold 4C

The product is about 1 kb.  Good luck!

Manuel

Manuel B. Sainz, Ph.D.
Department of Plant Biology
111 Koshland Hall
University of California
Berkeley, CA 94720
(510) 643-7230
fax (510) 642-4995
sainz at nature.berkeley.edu


From: SURAJ MUKATIRA <suraj at purdue.edu>

I use
5'-CTGAACTGGCAGACTATCC -3' which is located at the 3' end of the uidA
sequence. The other primer derives from the promoter fragment at the 5'
end of the gene.

PCR Conditions:
94 -10min

94 -1 min30 cycles
54 -1 min
72 -2 min

72 -20 min

0 - Infinity

P.S: Check the Tm of the primer on the promoter to adjust the anneling
temp.


From: SURAJ MUKATIRA <suraj at purdue.edu>

I use
5'-CTGAACTGGCAGACTATCC -3' which is located at the 3' end of the uidA
sequence. The other primer derives from the promoter fragment at the 5'
end of the gene.

PCR Conditions:
94 -10min

94 -1 min30 cycles
54 -1 min
72 -2 min

72 -20 min

0 - Infinity

P.S: Check the Tm of the primer on the promoter to adjust the anneling
temp.

good luck

suraj Mukatira
Purdue University

From: Mr N S Graham <lsrke at csv.warwick.ac.uk>

Dear Sarah,

If you look at our lab web pages at
www.transgene.ndirect.co.uk/lab/lab.html  there is a link to the lab
primer list. This contains primers for both the GUS and GFP genes, which I
have used on Arabidopsis lines. Our standard PCR conditions are:

95 C 1 min
hold at 72
add Taq

then 35 cycles of 95 for 15 sec, annealing for 15 sec, 72 for 15 sec.
then 72 for 10 mins.

Neil Graham

Plant Sci Divivsion
University of Nottingham
University Park
Nottingham
U.K.


Sarah Grant
Coker Hall CB#3280
Department of Biology
University of North Carolina
Chapel Hill, NC 27599-3280, USA
tel: (919) 962-7253
fax: (919) 962-1625
email: sgrant at email.unc.edu





More information about the Arab-gen mailing list