IUBio

24 Newly mapped SSR

Mary Polacco maryp at teosinte.agron.missouri.edu
Fri Oct 22 00:06:16 EST 1999


Dear Colleagues:

Newly mapped SSR entered into MaizeDB from the Missouri Maize
Project are provided  below. A complete listing is available at:
 
http://www.agron.missouri.edu/ssr.html

  Respectfully yours,
  Mary Polacco
  Curator MaizeDB
+++++++++++++++++++++++++++++++++++++++++++++++

Fields:
SSR, Bin(s), GenBank accession, forward sequence, reverse sequence

  umc1222      1.02- 1.03 
CTCAGAACAGAAGCCATCAAAAGC        CGTCTTCGTGAGAGACATCCTGT
  umc1073      1.03                 AI396479 
CACCAACGCCAATTAGCATCC           GTGGGCGTGTTCTCCTACTACTCA
  umc1220      1.11 
ATCTTTTTCCTTCCGAGCTGTACG        GTGGACGAGTCCGTGCTCAG
  umc1227      2.01- 2.03 
CAAGTTGGTGAGATGGATCTGTTG        GCTCCTGGGTCTTCCTCTCC
  umc1230      2.08- 2.10 
GCGATTTCAACTATTTGTGGTAAAGG      GTACGACCGTTGAAACTGTTGTTTT
  umc1223      3.04 
TTCAACAGATTCAGAGAAAGCACA        TTGATAATTAATCCGCAGCTCTCTC
  umc1067      4.04                 G10787 
ACTTGTACTACGCAGGACAGTTCG        AGCCTCTGTCTGGATGACTGAAC
  umc1194      4.07- 4.08           AI668269 
ACCACCAGACATGGGAAACTTCT         AAGGCGGACACTACTCTACCCTCT
  umc1050      4.10- 4.11           AI374559 
CGATACACATCCATCTTCAGGTAGC       GCCTTTGTACCAATACAAGCCAAG
  umc1180      4.10- 4.11           X57275 
GAAGCCCCTTGAAATGAATGAAC         CGACGTACGTATAGACTCGCTCAG
  umc1197      4.10- 4.11           L05934 
GGTGTAATTTAGGGAGTGTTTGTTCG      CCGCATAGATGTGCTTTCTAGGAG
  umc1226      5.02- 5.04 
GAACCTACTGACCTGCACGAGAC         TTTTCATCACACAAGAAGCAGCTC
  umc1224      5.02- 5.07 
CTGAGAGGTCCCAAAGGAGTACAA        ATGACCTGCACACAGAAAGAACAA
  umc1098      5.04- 5.07           G49467 
ATAACTCCTGCATCTTGTCAGCAA        CACAGGATAGAACCTTCTCAGCAAA
  umc1192      5.04- 5.07           AI712255 
GATCGAACTGCAGAGGAACAAGAG        CGCTCCACATCCACATCTACAC
  umc1221      5.05- 5.06 
GCAACAGCAACTGGCAACAG            AAACAGGCACAAAGCATGGATAG
  umc1225      5.08 
CTAGCTCCGTGTGAGTGAGTGAGT        TTCCTTCTTTCTTTCCTGTGCAAC
  umc1229      6.00- 6.01 
AAACTTCTCCCCCGCAGTTC            CACCAACTCCACCACGTTCC
  umc1186      6.00- 6.03           U10076 
TCAAGAACATAATAGGAGGCCCAC        AGCCAGCTTGATCTTTAGCATTTG
  umc1138      7.00- 7.02           AI665696 
ATCAGCATCCTCCATTCACACAT         CGGGAAATGCTAGAATTATGCTGA
  umc1141      8.04- 8.07           AI649713 
AGAGGAGAAAGAGACAGACAGGCA        CAGGAACTGAATGAAAGCAACTCA
  umc1161      8.05- 8.09           AI586471 
GGTACCGCTACTGCTTGTTACTGC        GCTCGCTGTTGGTAGCAAGTTTTA
  umc1054     10.03-10.04           AF043346 
CCGTCTTCTTCAGGGTGTTCC           GTGGAGTTAGTAGGGTCGTTGCAC
  umc1196     10.07                 AI622333 
CGTGCTACTACTGCTACAAAGCGA        AGTCGTTCGTGTCTTCCGAAACT


COMMENT: the below SSR have some proprietary contraints;
please refer to the records in MaizeDB for details
      umc1223
      umc1224
      umc1225
      umc1226
      umc1227
      umc1229
      umc1230
      umc1220
      umc1221
      umc1222



More information about the Maize mailing list

Send comments to us at biosci-help [At] net.bio.net