Dear Shane,
I've done a literature search on the muntjac deer from the point of view
of stability of morphology in the face of extreme differences in
karyotype. This example shows that the logic of the program of development
is pretty independent of the chromosomes. As to the evolutionary mechanism
that produced this situation, and differences in junk DNA, see the papers
listed below.
-Dick Gordon, U. Manitoba[Jul23,95]
On Fri, 21 Jul 1995, Shane McKee wrote:
> Someone posted recently on the fact that two closely related
> species of deer differ greatly in the number of chromosomes - one
> had only four pairs, while the other had forty, or something like
> that. Anyone know if the one with fewer chromosomes has any less
> junk DNA than the other, or are the chromosomes just ten times as
> big?
>> Anyone care to speculate as to how this situation came about in
> these deer? (Even as a thought experiment, it can be quite
> instructive).
>> All the best,
> Shane
>>>> Shane McKee (JHO, RVH, Belfast) | / Art becomes science when
>Shane at reservoir.win-uk.net --O-- you start trying to figure
> AGACTGCGCTTGCTTTACACATTTCTTCTC / | out what the heck you're doing
>Works on Muntjac Deer
from Dick Gordon's Bibliography
Brinkley, B.R., M.M. Valdivia, A. Tousson & S.L. Brenner (1984). Compound
kinetochores of the Indian muntjac. Evolution by linear fusion of unit
kinetochores. Chromosoma. 91(1), 1-11.
Duan, X.S. & S.Y. Lin (1983). Study of chromosomal replication of red
muntjac (Muntiacus muntjac). Sci. Sin. B. 26(9), 936-942.
Johnston, F.P., R.B. Church & C.C. Lin (1982). Chromosome rearrangement
between the Indian muntjac and Chinese muntjac is accompanied by a
deletion of middle repetitive DNA. Can. J. Biochem. 60(5), 497-506.
Korf, B.R., E.L. Gershey & E.G. Diacumakos (1982). Centromeres are
arranged in clusters throughout the muntjac cell cycle. Exp. Cell. Res.
139(2), 393-396.
Lee, C., R. Sasi & C.C. Lin (1993). Interstitial localization of
telomeric DNA sequences in the Indian muntjac chromosomes: further
evidence for tandem chromosome fusions in the karyotypic evolution of the
Asian muntjacs. Cytogenet. Cell. Genet. 63(3), 156-159.
Levy, H.P., R.A. Schultz & M.M. Cohen (1992). Comparative gene mapping in
the species Muntiacus muntjac. Cytogenet. Cell. Genet. 61(4), 276-281.
Levy, H.P., R.A. Schultz, J.V. Ordonez & M.M. Cohen (1993). DNA content
measurements and an improved idiogram for the Indian muntjac. Cytometry
14(4), 362-368.
Liming, S. & S. Pathak (1981). Gametogenesis in a male Indian muntjac X
Chinese muntjac hybrid. Cytogenet. Cell Genet. 30, 152-156.
Liming, S., Y. Yingying & D. Xingsheng (1980). Comparative cytogenetic
studies on the red muntjac, Chinese muntjac and their F1 hybrids.
Cytogen. Cell Genet. 26, 22-27.
Lin, C.C., R. Sasi, Y.S. Fan & Z.Q. Chen (1991). New evidence for tandem
chromosome fusions in the karyotypic evolution of Asian muntjacs.
Chromosoma. 101(1), 19-24.
Ma, K. & L.M. Shi (1988). [Comparative studies on synaptonemal complexes
in spermatocytes of Chinese muntjac Muntiacus reevesi, black muntjac M.
crinifrons and Indian muntjac M. muntjak]. I. Chuan. Hsueh. Pao. 15(4),
282-289.
Mullinger, A.M. & R.T. Johnson (1983). Units of chromosome replication
and packing. J. Cell. Sci. 179-193.
Paweletz, N., B.K. Vig & E.M. Finze (1989). Evolution of compound
centromeres. A new phenomenon. Cancer. Genet. Cytogenet. 42(1), 75-86.
Rachel, A.J., T. Sharma & V.V. Menon (1992). Differences in
sister-chromatid exchange frequency between homologous chromosomes in
Muntiacus muntjak. Mutat. Res. 283(3), 193-198.
Rattner, J.B. & Bazett-Jones-DP (1988). Electron spectroscopic imaging of
the centrosome in cells of the Indian muntjac. J. Cell. Sci. 91( Pt 1),
5-11.
Rattner, J.B. & Bazett-Jones-DP (1989). Kinetochore structure: electron
spectroscopic imaging of the kinetochore. J. Cell. Biol. 108(4),
1209-1219.
Scherthan, H. (1990). Localization of the repetitive telomeric sequence
(TTAGGG)n in two muntjac species and implications for their karyotypic
evolution. Cytogenet. Cell. Genet. 53(2-3), 115-117.
Scherthan, H., U. Arnason & A. Lima-de-Faria (1990). Localization of
cloned, repetitive DNA sequences in deer species and its implications for
maintenance of gene territory. Hereditas 112(1), 13-20.
Scherthan, H., U. Arnason & Lima-de-Faria-A (1987). The chromosome field
theory tested in muntjac species by DNA cloning and hybridization.
Hereditas. 107(2), 175-184.
Sen, P. & T. Sharma (1985). Characterization of G-banded chromosomes of
the Indian muntjac and progression of banding patterns through different
stages of condensation. Cytogenet. Cell. Genet. 39(2), 145-149.
Verma, R.S., J.P. Jacob & A. Babu (1986). Heterochromatin organization in
the nucleus of Indian muntjac (Muntiacus muntjak). Can. J. Genet. Cytol.
28(4), 628-630.
Wang, D.S., S.W. Li, C.Q. Zeng, R.X. Cheng & S.B. Xue (1988). Microtubule
and microfilament distribution and tubulin content in the cell cycle of
Indian muntjac cells. Cytometry. 9(4), 368-373.
Weier, H.U. & W.G. Eisert (1987). Two-parameter data acquisition system
for rapid slit-scan analysis of mammalian chromosomes. Cytometry. 8(1),
83-90.
Welter, D.A., D.A. Black & L.D. Hodge (1984). Chromosome stabilizing
structures in mitotic Indian muntjac (Muntiacus muntjak) cells.
Experientia. 40(8), 871-873.
Welter, D.A., D.A. Black & L.D. Hodge (1986). Chromatid behavior in late
mitosis: a scanning electron microscopy analysis of mammalian cell lines
with various chromosome numbers. Scan. Electron. Microsc. 1986(Pt 4),
1371-1379.
Wurster, D.H. & N.B. Atkin (1972). Muntjac chromosomes: a new karyotype
for Muntiacus muntjak. Experientia 28, 972-973.
Zinkowski, R.P., J. Meyne & B.R. Brinkley (1991). The
centromere-kinetochore complex: a repeat subunit model. J. Cell. Biol.
113(5), 1091-1110.
