IUBio

Clock or what???

Shane McKee shane at reservoir.win-uk.net
Mon Jul 24 08:02:32 EST 1995


 
In article <3uhet8$bth at studium.student.umu.se>,
 Ludvig Mortberg (Agneta.Guillemot at historia.umu.se) writes:

>Alright I agree to that the molecular clock is not a theory in the
>strictest sense. So what is it? Your definition on a previous thread:
>"There is data. From that data comes the concept of the molecular
>clock." Now what kind of molecular clock does the data support?
>According to everything I have read the data point to a clock that
>goes with a constant speed. Are there data that is in conflict with
>this? I think there is. 
>
>Data in conflict with the concept of the molecular clock with a
>constant speed, would be relative rate tests that prove that different
>species evolve at different speeds.
>
I can't disagree with you here. I think, due to various differences
between species, it's inevitable that there will be some
differences in the rate of DNA substitution, and the data seems to
bear this out to some degree. However, between some closely
related species, the rate of change may be even enough to validate
the idea of a clock. I think the important point to stress (and
probably the point you originally meant) is that there is no
universal stretch of DNA that can be used in every case as the one
fundamental molecular clock, from which all phylogeny must be
derived. 

There are just too many genes in too many organisms in too many
species evolving at too many different rates in too many
environments. This is where you need to exercise caution, and
bring together multiple strands of information to deduce the 'true'
value of the clock. For example, I might have a really poxy clock
that runs fast, slow, stop, go, pretty much at random. It's going
to be hard to tell the time by it, but it's still a clock...

So, yes, the concept of a *universal* molecular clock is a
non-runner, but special case clocks abound.

Take care,
Shane
 


Shane McKee (JHO, RVH, Belfast)  | /      Art becomes science when
Shane at reservoir.win-uk.net     --O--    you start trying to figure
AGACTGCGCTTGCTTTACACATTTCTTCTC / |  out what the heck you're doing



More information about the Mol-evol mailing list

Send comments to us at biosci-help [At] net.bio.net