IUBio

Crustacean ITS Phylogeny and PCR

Axayácatl Rocha Olivares arocha at UCSD.EDU
Thu Feb 6 22:34:32 EST 1997


I meant to say Phylum Arthropoda, the sequences are from Insects so they
are really from another subphylum ... was thinking Crustaceans. Oh! well. 

----------
> From: Ari Kahn <ak01706 at swt.edu>
> To: mol-evol at net.bio.net
> Subject: Crustacean ITS Phylogeny and PCR
> Date: Wednesday, February 05, 1997 6:36 PM
> 
> I am looking at the phylogeny of the crustacean Triops using rDNA (ITS)
> sequences.  DNA isolations of high molecular weight have been
> successful.  However, our ITS amplifications are not working.  The
> primers used were originally developed for fungus** and work in plants
> very well.  We fear that amplification is not possible because of the
> primer sequences.  Has anyone done any PCR work with crustaceans or
> other animals on the ITS region and if so, can you suggest some
> alternative primer sequences or a proven PCR method?  The sequences we
> are using have the following sequences:
> 
> P1:	GGAAGTAAAAGTCGTAACAAGG
> P4:	TCCTCCGCTTATTGATATGC
> 	
> and was taken from the following reference:
> 
> Kim, K-J. and Jansen, R.K.  (1994)  Comparison of phylogenetic
> hypotheses 	among different data sets in dwarf dandelions (Krigia ): 
> additional 	information from internal transcribed spacer sequences of
> nuclear 	ribosomal DNA.  Plant Syst. Evol.  190:  157-185.
> 
> **White, T. J., Burns, T., Lee, S., Taylor, J.  (199).  Amplification
> and direct 	sequencing of fungal ribosomal RNA genes for phylogenetics. 
> In Innis, 	M. A., Gelfand, D. H., Sninsky, J. J., White, T. J., (eds.), 
> PCR protocols:  a 	guide to methods and applications, pp. 315-322. 
> SanDiego, California.
> 
> Thank you,
> -- 
> 
> "There is a theory which states that if ever anybody discovers exactly
> what the Universe is for and why it is here, it will instantly disappear
> and be replaced by something even more bizarre and inexplicable. 
> There is another theory which states that this has already happened."
> *Douglas Adams
> 
> Ari Kahn
> ak01706 at swt.edu
> http://www.swt.edu/~ak01706
> http://www.bio.swt.edu/PE/pelab.html



More information about the Mol-evol mailing list

Send comments to us at biosci-help [At] net.bio.net