I meant to say Phylum Arthropoda, the sequences are from Insects so they
are really from another subphylum ... was thinking Crustaceans. Oh! well.
----------
> From: Ari Kahn <ak01706 at swt.edu>
> To: mol-evol at net.bio.net> Subject: Crustacean ITS Phylogeny and PCR
> Date: Wednesday, February 05, 1997 6:36 PM
>> I am looking at the phylogeny of the crustacean Triops using rDNA (ITS)
> sequences. DNA isolations of high molecular weight have been
> successful. However, our ITS amplifications are not working. The
> primers used were originally developed for fungus** and work in plants
> very well. We fear that amplification is not possible because of the
> primer sequences. Has anyone done any PCR work with crustaceans or
> other animals on the ITS region and if so, can you suggest some
> alternative primer sequences or a proven PCR method? The sequences we
> are using have the following sequences:
>> P1: GGAAGTAAAAGTCGTAACAAGG
> P4: TCCTCCGCTTATTGATATGC
>> and was taken from the following reference:
>> Kim, K-J. and Jansen, R.K. (1994) Comparison of phylogenetic
> hypotheses among different data sets in dwarf dandelions (Krigia ):
> additional information from internal transcribed spacer sequences of
> nuclear ribosomal DNA. Plant Syst. Evol. 190: 157-185.
>> **White, T. J., Burns, T., Lee, S., Taylor, J. (199). Amplification
> and direct sequencing of fungal ribosomal RNA genes for phylogenetics.
> In Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J., (eds.),
> PCR protocols: a guide to methods and applications, pp. 315-322.
> SanDiego, California.
>> Thank you,
> --
>> "There is a theory which states that if ever anybody discovers exactly
> what the Universe is for and why it is here, it will instantly disappear
> and be replaced by something even more bizarre and inexplicable.
> There is another theory which states that this has already happened."
> *Douglas Adams
>> Ari Kahn
>ak01706 at swt.edu>http://www.swt.edu/~ak01706>http://www.bio.swt.edu/PE/pelab.html