IUBio

Crustacean ITS Phylogeny and PCR

Axayácatl Rocha Olivares arocha at UCSD.EDU
Thu Feb 6 22:26:15 EST 1997


Ari, a quick Entrez search gave the following Arthropod matches. I'm sure
you'll be better off designing primers from sequences from the same
subphylum than using ones designed for another kingdom. Have Fun.

----------
> From: Ari Kahn <ak01706 at swt.edu>
> To: mol-evol at net.bio.net
> Subject: Crustacean ITS Phylogeny and PCR
> Date: Wednesday, February 05, 1997 6:36 PM
> 
> I am looking at the phylogeny of the crustacean Triops using rDNA (ITS)
> sequences.  DNA isolations of high molecular weight have been
> successful.  However, our ITS amplifications are not working.  The
> primers used were originally developed for fungus** and work in plants
> very well.  We fear that amplification is not possible because of the
> primer sequences.  Has anyone done any PCR work with crustaceans or
> other animals on the ITS region and if so, can you suggest some
> alternative primer sequences or a proven PCR method?  The sequences we
> are using have the following sequences:
> 
> P1:	GGAAGTAAAAGTCGTAACAAGG
> P4:	TCCTCCGCTTATTGATATGC
> 	
> and was taken from the following reference:
> 
> Kim, K-J. and Jansen, R.K.  (1994)  Comparison of phylogenetic
> hypotheses 	among different data sets in dwarf dandelions (Krigia ): 
> additional 	information from internal transcribed spacer sequences of
> nuclear 	ribosomal DNA.  Plant Syst. Evol.  190:  157-185.
> 
> **White, T. J., Burns, T., Lee, S., Taylor, J.  (199).  Amplification
> and direct 	sequencing of fungal ribosomal RNA genes for phylogenetics. 
> In Innis, 	M. A., Gelfand, D. H., Sninsky, J. J., White, T. J., (eds.), 
> PCR protocols:  a 	guide to methods and applications, pp. 315-322. 
> SanDiego, California.
> 
> Thank you,
> -- 
> 
> "There is a theory which states that if ever anybody discovers exactly
> what the Universe is for and why it is here, it will instantly disappear
> and be replaced by something even more bizarre and inexplicable. 
> There is another theory which states that this has already happened."
> *Douglas Adams
> 
> Ari Kahn
> ak01706 at swt.edu
> http://www.swt.edu/~ak01706
> http://www.bio.swt.edu/PE/pelab.html



More information about the Mol-evol mailing list

Send comments to us at biosci-help [At] net.bio.net