From owner-vectors@net.bio.net Wed Nov 01 22:00:00 1995 Path: biosci!LAMAR.COLOSTATE.EDU!dknudson From: dknudson@LAMAR.COLOSTATE.EDU (Dennis Knudson) Newsgroups: bionet.biology.vectors Subject: Biology of Disease Vectors Course Announcement Date: 2 Nov 1995 15:30:47 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 187 Sender: daemon@net.bio.net Distribution: world Message-ID: NNTP-Posting-Host: net.bio.net MacArthur Foundation Research Network on the Biology of Parasite Vectors: Biology of Disease Vectors Course ------------------------------------------------------------------------------- COLORADO STATE UNIVERSITY FORT COLLINS, COLORADO, USA 16 June-29 June, 1996 A unique course, "Biology of Disease Vectors", is offered at the Arthropod-borne and Infectious Diseases Laboratory of Colorado State University. Vectors, such as mosquitoes and ticks, transmit diseases to hundreds of millions of human beings, and the number of mortalities associated with these infections undoubtedly exceeds 1,000,000 each year. Some of these diseases, such as yellow fever and malaria, had been controlled to some extent, but are now resurging and are proving to be intractable. The basis for the resurgence of many of these diseases and the failure to control others is multifactorial: lack of trained vector-borne disease scientists, development of insecticide resistance in vector populations, diversion of public health funds to diseases considered to be more important, and lack of adequate vaccines or chemotherapy. The course "Biology of Disease Vectors" has been developed to address some of these issues, to help recruit scientists from other disciplines into the field, and to provide a common background, training, and conceptual framework for developing a new generation of vector-borne disease experts, who can apply modern molecular approaches to the study and control of parasite vectors. The course, which is offered at CSU each summer, is intended for scientists newly recruited into the field from areas such as molecular biology, molecular genetics, biochemistry, etc. and for those with more conventional training in the vector-borne diseases. Advanced graduate students, postdoctoral fellows, and independent investigators are introduced to the biology of disease vectors, emphasizing current molecular biological, genetic, biochemical, and physiological approaches. Approximately 30 students and 25 faculty participate in the course. Faculty are from Colorado State University, Yale University, the National Institutes of Health, the Centers for Disease Control, the United States Department of Agriculture, the University of Arizona, the University of California-Irvine, Case Western Reserve University, the University of Texas-Galveston and many other universities, institutes, etc. Students come from North America as well as many different countries. Small class size and selection of world-reknowned scientists for faculty provide an unparalleled learning experience. Financial aid may be provided based on need. For application form and further information contact: Dr Stephen Higgs, Arthropod-borne and Infectious Diseases Laboratory, Foothills Campus, Colorado State University, Fort Collins, Colorado 80523-1682. USA. Tel. 970 491 8604, Fax 970 491 8323, e-mail shiggs@vines.colostate.edu ------------------------------------------------------------------------------- Colorado State University is an equal opportunity/affirmative action institution and complies with all federal and Colorado state laws, regulations, and executive orders regarding affirmative action requirements in all programs. ------------------------------------------------------------------------------- Document was revised on Wednesday, 23 August 1995 at 9:40:33 ------------------------------------------------------------------------------- MacArthur Foundation Research Network on the Biology of Parasite Vectors: Biology of Disease Vectors Course Application ------------------------------------------------------------------------------- COLORADO STATE UNIVERSITY FORT COLLINS, COLORADO, USA 16 June-29 June, 1996 Deadline: Completed application, short CV, statement of career goals, and one letter of evaluation must be received by February 20, 1996. Notification of acceptance and financial aid will be mailed by March 20, 1996. Last Name (Surnom): _____________________________________ First Name (Prenom): _____________________________________ Gender: _____________________________________ Citizenship: _____________________________________ Social Security No.: _____________________________________ First language: _____________________________________ Second language: _____________________________________ (and competency) Business Address (for correspondence): ___________________________________________________________ ___________________________________________________________ ___________________________________________________________ Telephone Number: _____________________________________ (with all codes) FAX No: _____________________________________ e-mail: _____________________________________ How did you learn about this course: ___________________________________________________________ Do you want college credit for the course? ___________________________________________________________ Current Status: _____Graduate Student _____Postdoctoral _____Faculty _____Other (specify): _____________________________________ Education (Institution Degree Year) Undergraduate (B.S.) ___________________________________________________________ Graduate (M.S./Ph.D) ___________________________________________________________ Post-Doctoral ___________________________________________________________ Name, address and telephone number of an individual to contact in case of emergency: ___________________________________________________________ ___________________________________________________________ ___________________________________________________________ Financial Aid. If you are requesting financial aid, please check here and complete the following: _____I request financial assistance to attend the course. (Please state the specific areas in which assistance is required and the areas to which you or your institute can contribute). Estimated expenses: Tuition ~$1,500: _____________________________________ Room (13 nights on campus): Double Occupancy $220 _____________________________________ Single Occupancy $305 _____________________________________ Meals-on campus $180: _____________________________________ Travel to and from Fort Collins _____________________________________ Describe any conditions (financial, course credit, etc) that must be met by you or your institution for your participation in the course. ___________________________________________________________ ___________________________________________________________ ___________________________________________________________ Please ask one person to send a letter of evaluation directly to the course coordinator. Name and address of evaluator: ___________________________________________________________ ___________________________________________________________ ___________________________________________________________ Attach a one page statement describing your background and reasons for wanting to take this course and your subsequent career goals and interests. I affirm that the information given in this application is, to the best of my knowledge, correct. If accepted, I agree to attend all group activities and all class sessions. Date: _____________________________________ Signature: _____________________________________ Return completed application to: Dr.Stephen Higgs Arthropod Borne and Infectious Diseases Laboratory (AIDL) Foothills Campus Colorado State University Fort Collins, CO 80523-1682 USA FAX 970 491 8323 Tel 970 491 8604 e-mail shiggs@vines.colostate.edu ------------------------------------------------------------------------------- Colorado State University is an equal opportunity/affirmative action institution and complies with all federal and Colorado state laws, regulations, and executive orders regarding affirmative action requirements in all programs. ------------------------------------------------------------------------------- Document was revised on Wednesday, 23 August 1995 at 9:40:33 ------------------------------------------------------------------------------- From owner-vectors@net.bio.net Thu Nov 02 22:00:00 1995 Path: biosci!ihnp4.ucsd.edu!usc!elroy.jpl.nasa.gov!netline-fddi.jpl.nasa.gov!usenet.eel.ufl.edu!tank.news.pipex.net!pipex!newsfeed.internetmci.com!in2.uu.net!news.biu.ac.il!news.huji.ac.il!wisipc.weizmann.ac.il!pmac-ullman104.weizmann.ac.il!user Newsgroups: bionet.biology.vectors Subject: test Message-ID: From: lpdanon@weizmann.weizmann.ac.il Date: Thu, 2 Nov 1995 08:17:17 GMT Sender: news@wisipc.weizmann.ac.il (News User) Organization: Weizmann Institute of Science, Computation Center. Lines: 1 test From owner-vectors@net.bio.net Thu Nov 02 22:00:00 1995 Path: biosci!daresbury!not-for-mail From: "R. Chalk" Newsgroups: bionet.biology.vectors Subject: sterile culture of mosquitoes Date: 3 Nov 1995 16:48:17 -0000 Lines: 8 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <47dh4h$g9v@mserv1.dl.ac.uk> MIME-Version: 1.0 Original-To: vect-bio@dl.ac.uk Dear everyone, Does anybody out there know how to grow mosquitoes (Aedes aegypti or any other mosquito species) under sterile conditions, or any references for reading. Please mail any info. to SC1BCPAS@CR47C.STAFFS.AC.UK Paul Stewart. From owner-vectors@net.bio.net Thu Nov 02 22:00:00 1995 Path: biosci!daresbury!yama.mcc.ac.uk!zippy.dct.ac.uk!dundee.ac.uk!sunsite.doc.ic.ac.uk!dispatch.news.demon.net!demon!tank.news.pipex.net!pipex!usenet.eel.ufl.edu!news.interlog.com!news.dra.com!news.mid.net!newsfeed.internetmci.com!chi-news.cic.net!news.uiowa.edu!red.weeg.uiowa.edu!cgreiner Newsgroups: bionet.biology.vectors Subject: Re: Mosquito attractants Message-ID: From: "C. Greiner" Date: Fri, 3 Nov 1995 01:04:07 -0600 References: <199510311827.AA07750@sos.sos.net> Distribution: world Organization: University of Iowa, Iowa City, IA, USA NNTP-Posting-Host: red.weeg.uiowa.edu Mime-Version: 1.0 Content-Type: TEXT/PLAIN; charset=US-ASCII X-Sender: cgreiner@red.weeg.uiowa.edu In-Reply-To: <199510311827.AA07750@sos.sos.net> Lines: 33 Dr. Martin please forgive me if my ignorance of the subject shows in the following question but what would be the difference between your proposal and a bug zapper? If you could attract a mosquito to a surface that is coated with the bacteria couldn't you just electrify the surface and not have to take the chance of releasing a live bioengineered microbe into the environment or is your agent passed from mosquito to mosquito somehow? I am not a opponent of biotechnology, quite the contrary, but I do believe if you can perform the same function mechanically it is preferable. There are many ways to affect the health and well being of mammals, birds, fish and plants besides just having a pathological effect on their living cells e.g. a massive die-off of a beneficial insect or a harmless competitor of an extremely harmful insect. On 31 Oct 1995 max@SOS.SOS.NET wrote: > My colleagues and I have developed a bioinsecticide that is harmless > to mammals, birds, fish and plants, yet is deadly to insects. We've > tried it on a variety of insects with excellent results. Some folks at > EPA and WHO asked us if we had any intention of using our formulation > on mosquitos. At the time we didn't, but we are now reconsidering. Our > biopesticide is a bacteria, but, unlike Bt, it is alive. If it is > going to be effective, the mosquitos are going to have to come to it. > With this in mind, are there commercially available traps that attract > mosquitos? I've heard that CO2 and lactic acid attract mosquitos. Is > this true? If so, have people used them in traps? If we can draw > mosquitos to these traps or stations, we can insure that they will > come in contact with the bacteria. > > Your help would be appreciated. > > Dr. Stephen Martin > > From owner-vectors@net.bio.net Thu Nov 02 22:00:00 1995 Path: biosci!daresbury!sunsite.doc.ic.ac.uk!dispatch.news.demon.net!demon!news.sprintlink.net!news.netrail.net!news-out.internetmci.com!newsfeed.internetmci.com!news.msfc.nasa.gov!elroy.jpl.nasa.gov!swrinde!sdd.hp.com!vixen.cso.uiuc.edu!news.ecn.bgu.edu!newspump.wustl.edu!cerberus-138.wustl.edu!usenet From: HAVILAND@KIDS.WUSTL.EDU (David L. Haviland, Ph.D.) Newsgroups: bionet.biology.vectors Subject: pCDNA3 Vector Date: 3 Nov 1995 21:05:25 GMT Organization: Washington University School of Med. Lines: 20 Distribution: world Message-ID: <47e06m$17p@cerberus-138.wustl.edu> NNTP-Posting-Host: kids2.wustl.edu X-News-Reader: VMS NEWS v1.25 Greetings: There was a rumor a while back that the pCDNA3 vector had a cryptic E. coli promoter site at or around the HindIII site in its polylinker. Can anyone confirm this? Thanks in advance, David =========================================================================== + David L. Haviland, Ph.D. Internet:"haviland@kids.wustl.edu" + + Washington Univ. School of Med. A.K.A : The Compiler + + Dept. of Peds./Pulm. Box 8116 ICBM-Net : Just hit St. Louis + + 400 S. Kingshighway &-6 <- User is Brain Dead... + + St. Louis, MO 63110 FAX: 314-454-2476 + + (314) 454-6076 + + ------------------------------------------------------------------- + + Will clone and sequence genes for food. + =========================================================================== From owner-vectors@net.bio.net Fri Nov 03 22:00:00 1995 Path: biosci!rutgers!csn!carbon!night.primate.wisc.edu!sdd.hp.com!swrinde!tank.news.pipex.net!pipex!usenet.eel.ufl.edu!newsfeed.internetmci.com!chi-news.cic.net!simtel!swidir.switch.ch!scsing.switch.ch!news.belwue.de!News.Uni-Marburg.DE!pcmf15.Med-Forschung.Uni-Marburg.DE!melcher From: melcher@mathematik.uni-marburg.de (Ralph Melcher) Newsgroups: bionet.biology.vectors Subject: Looking for vector sequence Date: Fri, 3 Nov 1995 17:20:54 LOCAL Organization: Physiologische Chemie, Uni-Marburg Lines: 16 Distribution: world Message-ID: NNTP-Posting-Host: pcmf15.med-forschung.uni-marburg.de Summary: I am looking for the sequence of pBEHpac18, pSV2-pac, pVN3.1 Keywords: Sequence of pBEHpac18, pSV2-pac, pVN3.1 X-Newsreader: Trumpet for Windows [Version 1.0 Rev B final beta #4] Hi netters, I am looking for the Sequence of the cloning vectors pBEHpac18 pSV2-pac pVN3.1 I searched every database i could find (EMBL,NIH,Vector sequence database, etc.) with no success. Please help me. My E-Mail adress is : melcher@mathematik.uni-marburg.de Many thanks From owner-vectors@net.bio.net Fri Nov 03 22:00:00 1995 Path: biosci!SOS.SOS.NET!max From: max@SOS.SOS.NET Newsgroups: bionet.biology.vectors Subject: Re: Mosquito attractants Date: 3 Nov 1995 16:02:48 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 43 Sender: daemon@net.bio.net Distribution: world Message-ID: <199511040000.AA24395@sos.sos.net> References: NNTP-Posting-Host: net.bio.net Our bacteria secrete chitinase enzymes which attack the exoskeleton of insects. They only make chitinases in the presence of chitin. They are not genetically engineered, therefore, the EPA does not object. Bug zappers are toys, which could not be used in rural areas where there is no electricity. Our bacteria are alive, unlike Bt, and therefore must be strategically placed in order to attract insects. The problem is not the biopesticide, but the attraction to the biopesticide by specific insects. This is why we are interested in research done on the subject of insect attractants. We are getting a good response from around the NET on this subject. We are very grateful. Your concerns about the ecosystem are legitimate. Genetically engineered bacteria do exist which make massive amounts of chitinases without feedback constraint. The EPA will never allow them to be released into the environment, nor should they. Our bugs will not make chitinases in the absence of chitin. They will utilize another carbon source to survive. Granted, our bacteria will kill beneficial insects. So do bug zappers, Bt, and chemical pesticides. This isn't an issue. Bt is sprayed from planes over swamps. This is a fairly non-selective method of pest control (some Bt strains do kill selective insects). Biologically, the best pest control is species specific. This only occurs with traditional biological control agents like parasitic wasps. Economically, the best pest control agent is non-specific. You aren't forced to re-invent the wheel everytime a new insect pest problem arises. It also has to be cheap, and as harmless to the environment as possible. Our biopesticide virtually defines non-selectivity, it is harmless to anything that does not contain chitin, it is subject to feedback inhibition (no chitin, no chitinase needed to break it down), and it is relatively cheap. It is a LIVE pesticide. Constant reapplications are not necessary. It is not perfect by any means. In fact, our bugs were isolated from a dying bee hive. It was dying because it was infected with the bacteria. The bacteria will do the same to any other insect nest that it encounters. This is both good and bad. We would like to wipe out fire ant, carpenter ant, and termite nests and we fully expect to be able to do so. BUT, we do not want honey bees to come in contact with it. To steal a line from the movie Ghostbusters, "THAT WOULD BE BAD!!!". Therefore, the biopesticide has to be applied correctly. As I said, your concerns are legitimate. If you have any further questions, please feel free to inquire. From owner-vectors@net.bio.net Fri Nov 03 22:00:00 1995 Path: biosci!TUNKU.UADY.MX!grejon From: grejon@TUNKU.UADY.MX (Garcia Rejon Julian) Newsgroups: bionet.biology.vectors Subject: (none) Date: 4 Nov 1995 09:57:58 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 20 Sender: daemon@net.bio.net Distribution: world Message-ID: NNTP-Posting-Host: net.bio.net suscribe ############################################ ## ## ## JULIAN E. GARCIA REJON ## ## CENTRO DE INVESTIGACIONES REGIONALES ## ## "DR. HIDEYO NOGUCHI" UADY ## ## LABORATORIO DE ARBOVIROLOGIA ## ## MERIDA, YUCATAN. MEXICO ## ## AP. POSTAL 1247-A ## ## CP. 97000. ## ## TEL (99) 24-57-55 EXT.136 ## ## FAX (99) 23-61-20 ## ## e-mail:grejon@tunku.uady.mx ## ## ## ## ## ############################################ From owner-vectors@net.bio.net Mon Nov 06 22:00:00 1995 Path: biosci!rutgers!dziuxsolim.rutgers.edu!igor.rutgers.edu!newsserver.jvnc.net!news.caren.net!news.join.ad.jp!wnoc-tyo-news!wnoc-sfc-news!wnoc-kyo-news!aist-nara!odins-suita!odins-sci!grape.bio.sci.osaka-u.ac.jp!user From: shiraga4@bio.sci.osaka-u.ac.jp (Shin-ichiro HIRAGA) Newsgroups: bionet.biology.vectors Subject: pET-3a Sequence and Map Date: 7 Nov 1995 11:23:24 GMT Organization: Osaka University Lines: 17 Message-ID: NNTP-Posting-Host: grape.bio.sci.osaka-u.ac.jp Hi, I have been looking for the sequence and map (EndoR, genes) of T7-expressing vector, pET-3a. I could not found it in Entrez database. Could anyone give me any information? Thank you in advance, -- Shin-ichiro Hiraga Graduate Student Laboratory of Genetics Faculty of Science Osaka University Toyonaka, Osaka 560 Japan shiraga4@bio.sci.osaka-u.ac.jp From owner-vectors@net.bio.net Mon Nov 06 22:00:00 1995 Path: biosci!daresbury!sunsite.doc.ic.ac.uk!warwick!bham!usenet From: Gabriel Landini Newsgroups: bionet.biology.vectors Subject: NEW BOOK Date: Tue, 07 Nov 1995 10:13:33 -0800 Organization: The University of Birmingham, UK. Lines: 24 Message-ID: <309FA1CD.6CA9@bham.ac.uk> NNTP-Posting-Host: dial1.bham.ac.uk Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 2.0b1 (Windows; I; 16bit) New book! Pickover, C. (1995) FUTURE HEALTH, Computers and Medicine in the Twenty-First Century. St. Martin's Press: New York. ISBN 0-312-12602-6. This collection considers the tremendous effects that computers will have on medicine and medical service in the next century. The book also gives a sampling of state-of-the-art application of computers in medicine. The chapters describe: o futuristic operating rooms o the challenges of future medical schools in preparing 21st-century physicians o futuristic fractal models in pathology o the use of new medical imaging technologies o the use of electronic gophers to obtain medical information o digital dentistry o the use of artificial intelligence in medical diagnosis o computer conferencing for medical consulting o bloodless robotic surgery o making solid models from medical images o futuristic examinations rooms and much more.... From owner-vectors@net.bio.net Wed Nov 08 22:00:00 1995 Path: biosci!rutgers!spcuna!uunet!in2.uu.net!news.sprintlink.net!dispatch.news.demon.net!demon!sunsite.doc.ic.ac.uk!daresbury!not-for-mail From: (Zoe Adams) Newsgroups: bionet.biology.vectors Subject: Re: Short Course at the Natural History Museum, London Date: 8 Nov 1995 15:47:07 -0000 Lines: 23 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <47qjdr$5i1@mserv1.dl.ac.uk> X-POPmail-Charset: British Original-To: vect-bio@dl.ac.uk ANNUAL INTERNATIONAL COURSE ON IDENTIFICATION OF INSECTS & OTHER ARTHROPODS OF MEDICAL & VETERINARY IMPORTANCE. 1st - 19th July 1996: London, UK For Details contact: Ms Zoe Adams Department of Entomology Medical & Veterinary Division The Natural History Museum Cromwell Road London SW7 5BD UK phone: 44 + 0171 938 9329/9125 fax: 44 + 0171 938 9395/8937 e-mail: zjoa@nhm.ac.uk Zoe Adams Medical & Veterinary Division Entomology Department Natural History Museum Cromwell Road, London, SW7 5BD Tel: 0171 938 9329 Fax: 0171 938 9395 INTERNET: zjoa@nhm.ac.uk JANET: Z.Adams@uk.ac.nhm From owner-vectors@net.bio.net Thu Nov 09 22:00:00 1995 Path: biosci!rutgers!csn!carbon!night.primate.wisc.edu!sdd.hp.com!swrinde!elroy.jpl.nasa.gov!news.msfc.nasa.gov!newsfeed.internetmci.com!in1.uu.net!newstf01.news.aol.com!newsbf02.news.aol.com!not-for-mail From: pdelrio@aol.com (PDelrio) Newsgroups: bionet.biology.vectors Subject: Re: Mosquito attractants Date: 10 Nov 1995 13:21:31 -0500 Organization: America Online, Inc. (1-800-827-6364) Lines: 16 Sender: root@newsbf02.news.aol.com Message-ID: <48057b$rvc@newsbf02.news.aol.com> References: <199510311827.AA07750@sos.sos.net> Reply-To: pdelrio@aol.com (PDelrio) NNTP-Posting-Host: newsbf02.mail.aol.com Yes, it is true that mosquito (adult females) are attracted by CO2. A few years ago I had a student part-time position at an arbovirus field research station in the San Joaquin Valley, CA and we set up and maintained traps for mosquitoes. They consisted of a bag of dry ice atttached to a battery operated small fan which blew the attracted insects into a net trap. (Actually sucked them into the net like a small vacuum cleaner. ) There was also a small lightbulb attached to each trap as light also attracts most nocturnal flying insects. These were, of course, live traps and were very effective. One small trap on a warm summer's night could catch hundreds of insects, including mosquitos, which were then sorted and typed by species. A good source of mosquito expertice is the School of Public Health at UC Berkeley, specifically the Arbovirus (Encephalitis) research group. They may be the WFA's when it comes to mosquitoes. UC Berkeley has a huge WWW website which will probably get you to the arbovirus group. If you use a good web browser I think you'll find the information you need there. From owner-vectors@net.bio.net Sat Nov 11 22:00:00 1995 Path: biosci!IX.NETCOM.COM!borschel From: borschel@IX.NETCOM.COM (Richard Borschel) Newsgroups: bionet.biology.vectors Subject: MOsquito Diet and Normal Flora Date: 12 Nov 1995 03:38:31 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 8 Sender: daemon@net.bio.net Distribution: world Message-ID: <199511121133.DAA18494@ix7.ix.netcom.com> NNTP-Posting-Host: net.bio.net I am looking for references on the bacterial diet of mosquito larvae and the normal intestinal flora of the adult mosquito. I have searched MEDLINE with no success. Is there a better database for this? Thanks. Major Richard Borschel Walter Reed Army Medical Center Washington, DC 20307 borschel@ix.netcom.com From owner-vectors@net.bio.net Mon Nov 13 22:00:00 1995 Newsgroups: bionet.biology.vectors Path: biosci!rutgers!concert!news-server.ncren.net!news.duke.edu!solaris.cc.vt.edu!news.bluesky.net!news.sprintlink.net!news.uoregon.edu!tank.news.pipex.net!pipex!newsfeed.internetmci.com!in2.uu.net!news2.new-york.net!not-for-mail From: Steve Grenard Subject: Re: MOsquito Diet and Normal Flora Content-Type: text/plain; charset=us-ascii X-Nntp-Posting-User: (Unauthenticated) To: borschel@IX.NETCOM.COM Content-Transfer-Encoding: 7bit Organization: Herpmed Communications Message-ID: References: <199511121133.DAA18494@ix7.ix.netcom.com> X-Mailer: Mozilla 1.1PE (Windows; I; 16bit) Mime-Version: 1.0 X-Nntp-Posting-Host: herpmed.com Date: Mon, 13 Nov 1995 18:12:59 GMT Lines: 14 Try the Entomology Index which can be accessed through our Index Page at: http://www.herpmed.com/ Scroll down to Arachnids, and Other Bugs category and you'll find a number of sites which may be able to help you including all the Entomology Sites available site. Steve Grenard grenard@herpmed.com From owner-vectors@net.bio.net Thu Nov 16 22:00:00 1995 Path: biosci!ihnp4.ucsd.edu!swrinde!sdd.hp.com!col.hp.com!simtel!swidir.switch.ch!scsing.switch.ch!news.belwue.de!news.uni-freiburg.de!jr From: jr@deep-thought.biologie.uni-freiburg.de (Jan Reichert) Newsgroups: bionet.biology.vectors Subject: Re: pET-3a Sequence and Map Date: 17 Nov 1995 00:29:49 GMT Organization: Rechenzentrum der Universitaet Freiburg, Germany Lines: 110 Message-ID: <48gl1t$as4@n.ruf.uni-freiburg.de> References: Reply-To: Leone@reply.is.no.save.method NNTP-Posting-Host: bop1.biologie.uni-freiburg.de X-Newsreader: TIN [version 1.2 PL2] Shin-ichiro HIRAGA (shiraga4@bio.sci.osaka-u.ac.jp) wrote: : Hi, : I have been looking for the sequence and map (EndoR, genes) of : T7-expressing vector, pET-3a. I could not found it in Entrez database. : Could anyone give me any information? : Thank you in advance, It had been a great vast of time, but I was foolish enough, though I followed all cloning steps in these nice paper, we all know, and finally ended up with the following sequence: Expressionvector pAR3040 A.H.Rosenberg et.al. Gene 56 (1987) 125-135@ compiled by J. Reichert provided "as is" without express or implied warranty GPL 1992$ GAATTCTCATGTTTGACAGCTTATCATCGATAAGCTTTAATGCGGTAGTTTATCACAGTT AAATTGCTAACGCAGTCAGGCACCGTGTATGAAATCTAACAATGCGCTCATCGTCATCCT CGGCACCGTCACCCTGGATGCTGTAGGCATAGGCTTGGTTATGCCGGTACTGCCGGGCCT CTTGCGGGATATCGTCCATTCCGACAGCATCGCCAGTCACTATGGCGTGCTGCTAGCGCT ATATGCGTTGATGCAATTTCTATGCGCACCCGTTCTCGGAGCACTGTCCGACCGCTTTGG CCGCCGCCCAGTCCTGCTCGCTTCGCTACTTGGAGCCACTATCGACTACGCGATCATGGC GACCACACCCGTCCTGTGGATATCCGGATATAGTTCCTCCTTTCAGCAAAAAACCCCTCA AGACCCGTTTAGAGGCCCCAAGGGGTTATGCTAGTTATTGCTCAGCGGTGGCAGCAGCCA ACTCAGCTTCCTTTCGGGCTTTGTTAGCAGCCGGATCCGCGACCCATTTGCTGTCCACCA GTCATGCTAGCCATATGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGGGA AACCGTTGTGGTCTCCCTATAGTGAGTCGTATTAATTTCGCGGGATCGAGATCTCGATCC TCTACGCCGGACGCATCGTGGCCGGCATCACCGGCGCCACAGGTGCGGTTGCTGGCGCCT ATATCGCCGACATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATGAGCGCTT GTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGGACTGTTGGGCGCCATCTCCT TGCATGCACCATTCCTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCT TCCTAATGCAGGAGTCGCATAAGGGAGAGCGTCGACCGATGCCCTTGAGAGCCTTCAACC CAGTCAGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCT TCTTTATCATGCAACTCGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGG ACCGCTTTCGCTGGAGCGCGACGATGATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGC ACGCCCTCGCTCAAGCCTTCGTCACTGGTCCCGCCACCAAACGTTTCGGCGAGAAGCAGG CCATTATCGCCGGCATGGCGGCCGACGCGCTGGGCTACGTCTTGCTGGCGTTCGCGACGC GAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGGCATCGGGATGCCCG CGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAAGGAT CGCTCGCGGCTCTTACCAGCCTAACTTCGATCACTGGACCGCTGATCGTCACGGCGATTT ATGCCGCCTCGGCGAGCACATGGAACGGGTTGGCATGGATTGTAGGCGCCGCCCTATACC TTGTCTGCCTCCCCGCGTTGCGTCGCGGTGCATGGAGCCGGGCCACCTCGACCTGAATGG AAGCCGGCGGCACCTCGCTAACGGATTCACCACTCCAAGAATTGGAGCCAATCAATTCTT GCGGAGAACTGTGAATGCGCAAACCAACCCTTGGCAGAACATATCCATCGCGTCCGCCAT CTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCTGGCCACGGGTGCGCAT GATCGTGCTCCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTGCCTTACTGGTTAGCA GAATGAATCACCGATACGCGAGCGAACGTGAAGCGACTGCTGCTGCAAAACGTCTGCGAC CTGAGCAACAACATGAATGGTCTTCGGTTTCCGTGTTTCGTAAAGTCTGGAAACGCGGAA GTCAGCGCCCTGCACCATTATGTTCCGGATCTGCATCGCAGGATGCTGCTGGCTACCCTG TGGAACACCTACATCTGTATTAACGAAGCGCTGGCATTGACCCTGAGTGATTTTTCTCTG GTCCCGCCGCATCCATACCGCCAGTTGTTTACCCTCACAACGTTCCAGTAACCGGGCATG TTCATCATCAGTAACCCGTATCGTGAGCATCCTCTCTCGTTTCATCGGTATCATTACCCC CATGAACAGAAATTCCCCCTTACACGGAGGCATCAAGTGACCAAACAGGAAAAAACCGCC CTTAACATGGCCCGCTTTATCAGAAGCCAGACATTAACGCTTCTGGAGAAACTCAACGAG CTGGACGCGGATGAACAGGCAGACATCTGTGAATCGCTTCACGACCACGCTGATGAGCTT TACCGCAGCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTC CCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGC GCGTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGC GGAGTGTATACTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATA TATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCTCTTC CGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGC TCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACAT GTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTT CCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCG AAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTC TCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGT GGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAA GCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTA TCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAA CAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAA CTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTT CGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTT TTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGAT CTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCAT GAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATC AATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGC ACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTA GATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGA CCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCG CAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGC TAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTGCAGGCAT CGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAG GCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGAT CGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAA TTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAA GTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAACACGGGA TAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGG GCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGC ACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGG AAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACT CTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACAT ATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGT GCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTAT CACGAGGCCCTTTCGTCTTCAA* -- .................................................... . . . Jan Reichert jr@bop1.biologie.uni-freiburg.de . . Biologie II . . Scha"nzlestr.1 voice D-761/203-2699 or -2703 . . D-79104 Freiburg . . . . http://www.biologie.uni-freiburg.de . . /data/people/jan_reichert.html . . . .................................................... From owner-vectors@net.bio.net Thu Nov 16 22:00:00 1995 Path: biosci!BAYLOR.EDU!Rick_Duhrkopf From: Rick_Duhrkopf@BAYLOR.EDU (Rick Duhrkopf) Newsgroups: bionet.biology.vectors Subject: Re: pET-3a Sequence and Map Date: 17 Nov 1995 05:53:15 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 9 Sender: daemon@net.bio.net Distribution: world Message-ID: NNTP-Posting-Host: net.bio.net Subject: Time: 7:46 AM OFFICE MEMO RE>pET-3a Sequence and Map Date: 11/17/95 Am I in the wrong place? I thought I was subscribing to a listserver dealing with vector biology. I thought that referred to the biology of vectors such as mosquitoes, ticks, tse-tse flies, and the like. R. Duhrkopf From owner-vectors@net.bio.net Thu Nov 16 22:00:00 1995 Path: biosci!galaxy.ucr.edu!ihnp4.ucsd.edu!swrinde!newsfeed.internetmci.com!in1.uu.net!nctuccca.edu.tw!serv.HiNet.net!usenet From: evans@serv.hinet.net (¦¿¨Î°¶) Newsgroups: bionet.biology.vectors Subject: Re: pET-3a Sequence and Map Date: 17 Nov 1995 12:18:55 GMT Organization: HiNet Lines: 113 Message-ID: <48hujf$5mj@serv.hinet.net> References: <48gl1t$as4@n.ruf.uni-freiburg.de> NNTP-Posting-Host: 168.95.110.132 X-Newsreader: Winspan < ¤¤¤å version 3.10 > > >Shin-ichiro HIRAGA (shiraga4@bio.sci.osaka-u.ac.jp) wrote: >: Hi, > >: I have been looking for the sequence and map (EndoR, genes) of >: T7-expressing vector, pET-3a. I could not found it in Entrez database. >: Could anyone give me any information? > >: Thank you in advance, > >It had been a great vast of time, but I was foolish enough, though I followed >all cloning steps in these nice paper, we all know, and finally ended up with >the following sequence: > >Expressionvector pAR3040 A.H.Rosenberg et.al. Gene 56 (1987) >125-135@ >compiled by J. Reichert provided "as is" without express or >implied warranty >GPL 1992$ >GAATTCTCATGTTTGACAGCTTATCATCGATAAGCTTTAATGCGGTAGTTTATCACAGTT >AAATTGCTAACGCAGTCAGGCACCGTGTATGAAATCTAACAATGCGCTCATCGTCATCCT >CGGCACCGTCACCCTGGATGCTGTAGGCATAGGCTTGGTTATGCCGGTACTGCCGGGCCT >CTTGCGGGATATCGTCCATTCCGACAGCATCGCCAGTCACTATGGCGTGCTGCTAGCGCT >ATATGCGTTGATGCAATTTCTATGCGCACCCGTTCTCGGAGCACTGTCCGACCGCTTTGG >CCGCCGCCCAGTCCTGCTCGCTTCGCTACTTGGAGCCACTATCGACTACGCGATCATGGC >GACCACACCCGTCCTGTGGATATCCGGATATAGTTCCTCCTTTCAGCAAAAAACCCCTCA >AGACCCGTTTAGAGGCCCCAAGGGGTTATGCTAGTTATTGCTCAGCGGTGGCAGCAGCCA >ACTCAGCTTCCTTTCGGGCTTTGTTAGCAGCCGGATCCGCGACCCATTTGCTGTCCACCA >GTCATGCTAGCCATATGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGGGA >AACCGTTGTGGTCTCCCTATAGTGAGTCGTATTAATTTCGCGGGATCGAGATCTCGATCC >TCTACGCCGGACGCATCGTGGCCGGCATCACCGGCGCCACAGGTGCGGTTGCTGGCGCCT >ATATCGCCGACATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATGAGCGCTT >GTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGGACTGTTGGGCGCCATCTCCT >TGCATGCACCATTCCTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCT >TCCTAATGCAGGAGTCGCATAAGGGAGAGCGTCGACCGATGCCCTTGAGAGCCTTCAACC >CAGTCAGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCT >TCTTTATCATGCAACTCGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGG >ACCGCTTTCGCTGGAGCGCGACGATGATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGC >ACGCCCTCGCTCAAGCCTTCGTCACTGGTCCCGCCACCAAACGTTTCGGCGAGAAGCAGG >CCATTATCGCCGGCATGGCGGCCGACGCGCTGGGCTACGTCTTGCTGGCGTTCGCGACGC >GAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGGCATCGGGATGCCCG >CGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAAGGAT >CGCTCGCGGCTCTTACCAGCCTAACTTCGATCACTGGACCGCTGATCGTCACGGCGATTT >ATGCCGCCTCGGCGAGCACATGGAACGGGTTGGCATGGATTGTAGGCGCCGCCCTATACC >TTGTCTGCCTCCCCGCGTTGCGTCGCGGTGCATGGAGCCGGGCCACCTCGACCTGAATGG >AAGCCGGCGGCACCTCGCTAACGGATTCACCACTCCAAGAATTGGAGCCAATCAATTCTT >GCGGAGAACTGTGAATGCGCAAACCAACCCTTGGCAGAACATATCCATCGCGTCCGCCAT >CTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCTGGCCACGGGTGCGCAT >GATCGTGCTCCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTGCCTTACTGGTTAGCA >GAATGAATCACCGATACGCGAGCGAACGTGAAGCGACTGCTGCTGCAAAACGTCTGCGAC >CTGAGCAACAACATGAATGGTCTTCGGTTTCCGTGTTTCGTAAAGTCTGGAAACGCGGAA >GTCAGCGCCCTGCACCATTATGTTCCGGATCTGCATCGCAGGATGCTGCTGGCTACCCTG >TGGAACACCTACATCTGTATTAACGAAGCGCTGGCATTGACCCTGAGTGATTTTTCTCTG >GTCCCGCCGCATCCATACCGCCAGTTGTTTACCCTCACAACGTTCCAGTAACCGGGCATG >TTCATCATCAGTAACCCGTATCGTGAGCATCCTCTCTCGTTTCATCGGTATCATTACCCC >CATGAACAGAAATTCCCCCTTACACGGAGGCATCAAGTGACCAAACAGGAAAAAACCGCC >CTTAACATGGCCCGCTTTATCAGAAGCCAGACATTAACGCTTCTGGAGAAACTCAACGAG >CTGGACGCGGATGAACAGGCAGACATCTGTGAATCGCTTCACGACCACGCTGATGAGCTT >TACCGCAGCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTC >CCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGC >GCGTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGC >GGAGTGTATACTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATA >TATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCTCTTC >CGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGC >TCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACAT >GTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTT >CCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCG >AAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTC >TCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGT >GGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAA >GCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTA >TCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAA >CAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAA >CTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTT >CGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTT >TTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGAT >CTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCAT >GAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATC >AATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGC >ACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTA >GATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGA >CCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCG >CAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGC >TAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTGCAGGCAT >CGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAG >GCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGAT >CGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAA >TTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAA >GTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAACACGGGA >TAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGG >GCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGC >ACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGG >AAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACT >CTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACAT >ATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGT >GCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTAT >CACGAGGCCCTTTCGTCTTCAA* > >-- > >.................................................... >. . >. Jan Reichert jr@bop1.biologie.uni-freiburg.de . >. Biologie II . >. Scha"nzlestr.1 voice D-761/203-2699 or -2703 . >. D-79104 Freiburg . >. . >. http://www.biologie.uni-freiburg.de . >. /data/people/jan_reichert.html . >. . >.................................................... > From owner-vectors@net.bio.net Fri Nov 17 22:00:00 1995 Path: biosci!rutgers!csn!csn!nntp-xfer-2.csn.net!yuma!usenet From: "D.L. Knudson" Newsgroups: bionet.biology.vectors Subject: Re: pET-3a Sequence and Map Date: Fri, 17 Nov 1995 16:41:53 -0700 Organization: Colorado State University, Fort Collins, CO 80523 Lines: 20 Message-ID: <30AD1DC1.6CF5@klab.agsci.colostate.edu> References: NNTP-Posting-Host: klab.agsci.colostate.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 2.0b1J (X11; I; SunOS 5.4 sun4m) Rick Duhrkopf wrote: > > Subject: Time: 7:46 AM > OFFICE MEMO RE>pET-3a Sequence and Map Date: 11/17/95 > > Am I in the wrong place? I thought I was subscribing to a listserver dealing > with vector biology. I thought that referred to the biology of vectors such > as mosquitoes, ticks, tse-tse flies, and the like. > > R. Duhrkopf This about vectors such as mosquitoes etc - =*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*= Dr. Dennis L. Knudson, Professor of Entomology and Microbiology Department of Entomology Telephone: 970 491-7255 College of Agricultural Sciences Fax: 970 491-0564 Colorado State University Internet:dknudson@lamar.colostate.edu Fort Collins, CO 80523 USA URL http://klab.agsci.colostate.edu/ =*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*= From owner-vectors@net.bio.net Fri Nov 17 22:00:00 1995 Path: biosci!MSMAIL.BMS.COM!Rich_Lois_C.PRILVMS1 From: Rich_Lois_C.PRILVMS1@MSMAIL.BMS.COM ("Lois C. Rich") Newsgroups: bionet.biology.vectors Subject: Need Mosquito Pictures- help ! Date: 18 Nov 1995 11:13:27 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 8 Sender: daemon@net.bio.net Distribution: world Message-ID: <01HXSI2CEV6A005KUP@cliff.bms.com> NNTP-Posting-Host: net.bio.net Could someone please direct me to some mosquito pictures out here on the internet thast I could print out? I am doing a paper for my veterinary entomology class ! Please respons via E-mail to me directly. Thanks in advance. From owner-vectors@net.bio.net Sat Nov 18 22:00:00 1995 Path: biosci!rutgers!csn!magnus.acs.ohio-state.edu!usenet.ins.cwru.edu!agate!howland.reston.ans.net!swrinde!newsfeed.internetmci.com!usenet.eel.ufl.edu!col.hp.com!simtel!swidir.switch.ch!swsbe6.switch.ch!scsing.switch.ch!news.belwue.de!news.uni-ulm.de!rz.uni-karlsruhe.de!news.uni-stuttgart.de!uni-regensburg.de!pczeiss1.biologie.uni-regensburg.de!kuhn From: kuhn@alf1.ngate.uni-regensburg.de (Karl-Heinz Kuhn t2150) Newsgroups: bionet.biology.vectors Subject: Wrong group? Was:Re: pET-3a Sequence and Map Date: Sat, 18 Nov 1995 19:11:52 GMT Organization: University of Regensburg Lines: 37 Distribution: world Message-ID: References: NNTP-Posting-Host: pczeiss1.biologie.uni-regensburg.de X-Newsreader: Trumpet for Windows [Version 1.0 Rev B final beta #4] In article Rick_Duhrkopf@BAYLOR.EDU (Rick Duhrkopf) writes: > Subject: Time: 7:46 AM > OFFICE MEMO RE>pET-3a Sequence and Map Date: 11/17/95 >Am I in the wrong place? I thought I was subscribing to a listserver dealing >with vector biology. I thought that referred to the biology of vectors such >as mosquitoes, ticks, tse-tse flies, and the like. >R. Duhrkopf Oh, no. This is the right group for you. Unfortunately, the people working on arthropod (and other?) vectors of disease (producing pathogens) seem to be shy. I am sure that discussions on 'mosquitoes, ticks, tse-tse flies, and the like' will be going on soon. I am working on the immunobiology of ticks / invertebrate immunity / interaction of Ixodes ticks internal defense with Borrelia burgdorferi, the causative agent of Lyme disease. Any questions? Any advices? Greetings. Karl (-Heinz) _________________________________________________ Karl-Heinz Kuhn Institut fuer Zoologie / Biologie I Universtaet Regensburg D-93049 Regensburg** _________________________________________________ e-mail: Karl-Heinz.Kuhn@biologie.uni-regensburg.de _________________________________________________ ** To learn more about Regensburg visit our home page at http://www.uni-regensburg.de and click on REGENSBURG _________________________________________________ From owner-vectors@net.bio.net Sat Nov 18 22:00:00 1995 Path: biosci!rutgers!rockyd!news.sprintlink.net!newsfeed.internetmci.com!howland.reston.ans.net!vixen.cso.uiuc.edu!newsrelay.iastate.edu!news.iastate.edu!troendle.ent.iastate.edu!user From: jvandyk@iastate.edu (John VanDyk) Newsgroups: bionet.biology.vectors Subject: Re: Need Mosquito Pictures- help ! Date: 18 Nov 1995 21:19:20 GMT Organization: Iowa State University Lines: 27 Distribution: world Message-ID: References: <01HXSI2CEV6A005KUP@cliff.bms.com> NNTP-Posting-Host: troendle.ent.iastate.edu In article <01HXSI2CEV6A005KUP@cliff.bms.com>, Rich_Lois_C.PRILVMS1@MSMAIL.BMS.COM ("Lois C. Rich") wrote: > Could someone please direct me to some mosquito pictures out here on the > internet thast I could print out? I am doing a paper for my veterinary > entomology class ! Please respons via E-mail to me directly. > Thanks in advance. Pictures of several Iowa mosquitoes are available at the Iowa State Entomology Image Gallery, http://www.ent.iastate.edu/ImageGallery.html If you do not have access to the world wide web, they can be retrieved by gopher or anonymous ftp at gopher.ent.iastate.edu John VanDyk Entomology Index of Internet Resources at http://www.ent.iastate.edu/List/ -- John VanDyk, Medical Entomology Internet: jvandyk@iastate.edu -- 436 Science II, Iowa State Univ., Ames IA 50011 (USA) Phone 515-294-4387 http://www.public.iastate.edu/~jvandyk/ FAX 515-294-5957 +++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Ask me about Mosquito-L, the mosquito electronic mailing list! From owner-vectors@net.bio.net Sun Nov 26 22:00:00 1995 Newsgroups: bionet.biology.vectors Path: biosci!agate!howland.reston.ans.net!newsfeed.internetmci.com!in2.uu.net!news2.new-york.net!not-for-mail From: Steve Grenard Subject: Reptile-Associated Salmonellosis Website Content-Type: text/plain; charset=us-ascii X-Nntp-Posting-User: (Unauthenticated) Content-Transfer-Encoding: 7bit Organization: Herpmed Communications Message-ID: X-Mailer: Mozilla 1.1PE (Windows; I; 16bit) Mime-Version: 1.0 X-Nntp-Posting-Host: herpmed.com Date: Mon, 27 Nov 1995 03:06:05 GMT Lines: 9 You can find this website at: http://www.xmission.com/~gastown/herpmed/salm.htm Steve Grenard grenard@herpmed.com From owner-vectors@net.bio.net Mon Nov 27 22:00:00 1995 Path: biosci!internet!biosci!not-for-mail From: biohelp (BIOSCI Administrator) Newsgroups: bionet.biology.vectors Subject: IMPORTANT: BIOSCI miniFAQ Date: 28 Nov 1995 02:00:53 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 196 Sender: daemon@net.bio.net Distribution: world Message-ID: <199511281000.CAA28448@net.bio.net> NNTP-Posting-Host: net.bio.net This is a new "miniFAQ" designed to answer the questions that come up the *most frequently*. The main BIOSCI FAQ (Frequently Asked Questions) is accessible on the World Wide Web at URL http://www.bio.net/. Contents: -------- 1) What to do about "spams," i.e., junk mail, ads, etc. 2) Examples of subscribing and unsubscribing to the mailing lists. 3) How to access BIOSCI/bionet newsgroup archives. 4) The BIOSCI user address and research interest directory. 1) What to do about "spams," i.e., junk mail, ads, etc. ------------------------------------------------------- BIOSCI is a set of parallel USENET newsgroups (the "bionet" groups) and mailing lists. The same postings are distributed on both media (except for a small number of mailing-list-only groups at net.bio.net). Unfortunately it is becoming a despicable practice on the Internet (by a few people out to make a fast buck) to do automated mass postings to thousands of newsgroups and mailing lists. These attempts to grab free advertising are refered to as "spams" in the usual, somewhat boneheaded, net terminology. USENET is more susceptible to this practice, and many spams originate on the USENET groups and then are passed on to the mailing lists. However, spammers also get lists of mailing addresses and hit these too, so neither medium is immune. What should you do personally if you get junk mail? --------------------------------------------------- Just delete it and move on without reading it further. Filing a protest is becoming increasingly useless because spammers are often disguising the addresses where the messages are sent from. Unless you really understand Internet mail systems, your attempt at protest by sending replies to the message will often end up being sent to the address of an innocent person that the spammer is victimizing. What can BIOSCI/bionet do to protect its newsgroups? ---------------------------------------------------- The only solution currently available is to moderate the newsgroup. If this newsgroup is already moderated, then you are in good shape. Moderation protects the newsgroups from about 95% of the spams that are being sent to date. This means that someone has to take the time to review each message before it goes out. We have set up software here that simply allows the moderator to forward to an address at net.bio.net messages that (s)he wishes to have distributed. This takes no more time than that needed to read the message and pass it on, say about 1 min. per message. Most newsgroups currently have a discussion leader who is responsible for their newsgroup. The discussions leaders and their e-mail addresses are listed in the BIOSCI Information Sheet which is available on the Web at http://www.bio.net/. If a newsgroup is being hit with too many junk postings, please contact the discussion leader for that group and see if there is interest in moderating the group. Please do not assume that by simply posting a complaint to the newsgroup itself, anyone on the BIOSCI staff will act on your complaint. With close to 100 newsgroups to run, the BIOSCI staff has to rely on the discussion leaders of each newsgroup to report problems directly to us at biosci-help@net.bio.net. We will moderate any of our newsgroups if the discussion leader tells us that the readership of the group wishes to do so and if a moderator is willing to do the work. For most BIOSCI/bionet groups, this entails only a few minutes of work each day. Moderating a newsgroup will resolve probably 95% of the junk postings. Unfortunately there are easy ways for determined spammers to override the moderation mechanism. We are working on new systems to provide access to our newsgroups over the WWW. These should be available soon, probably November 1995, and will allow you to use your Web browser to look at the news postings. While this will not stop spammers from trying to post to the groups, this will give you yet another way, besides using USENET news, to keep the junk out of your personal mail files. 2) Examples of subscribing and unsubscribing to the mailing lists. ------------------------------------------------------------------ PLEASE NOTE: The BIOSCI management does NOT act on subscription/unsubscription requests that are posted improperly to the newsgroups and mailing lists. People who do this only bother everyone on the lists to no avail. Please be sure to follow the proper procedures below. Gory details are in the BIOSCI Information sheets on the Web at http://www.bio.net. Below we give an example utilizing the METHODS-AND-REAGENTS list at both of our two BIOSCI sites: Users in the Americas and Pacific Rim countries who use the BIOSCI ------------------------------------------------------------------ node at computer net.bio.net: ---------------------------- A) Determine the "listname" which is the <=8 character mail address ^^^^^^^^^^^^^ for the group. These can be found in the BIOSCI Info. Sheet. For the METHODS-AND-REAGENTS group the mailing address is methods@net.bio.net. The listname is the portion of the address to the left of the @ sign, i.e., "methods". The listname is used with the "subscribe" and "unsubscribe" commands illustrated below. B) Mail all commands in the body of a mail message addressed to biosci-server@net.bio.net. Do NOT send commands to the newsgroup posting addresses! Leave the Subject: line blank, any text on it will be ignored. C) In the body of your message put one or more of the following commands with an "end" command on the last line, e.g., subscribe methods unsubscribe methods end Do NOT put your e-mail address or other text on these lines. The server only allows you to cancel your subscription if the address on your mail header matches the address on our mailing list. Please ask for help at biosci-help@net.bio.net if your address has changed, e.g., if you know you are on the list but the server tells you that you are not a member. Users in Europe, Africa, and Central Asia who use the BIOSCI node at -------------------------------------------------------------------- computer daresbury.ac.uk (also known as dl.ac.uk): ------------------------------------------------- To subscribe and unsubscribe to/from the BIOSCI lists, you need to specify the full USENET newsgroup name with "bionet-news." prepended. The USENET newsgroup names are listed in the BIOSCI Information sheet on the Web at http://www.bio.net/. For the METHODS-AND-REAGENTS list the USENET newsgroup name is bionet.molbio.methds-reagnts, thus the appropriate commands are sub bionet-news.bionet.molbio.methds-reagnts unsub bionet-news.bionet.molbio.methds-reagnts These commands are included in a message addressed to mxt@dl.ac.uk, NOT to the newsgroup mailing addresses. As usual, include the text in the body of the message as text on the Subject: line is ignored. To unsubscribe from all the lists at the UK node, use unsub bionet-news Please note that if the address in the list is different than the one in your mail message header, you will not be able to unsubscribe by this method. If you have problems, please mail biosci@daresbury.ac.uk. 3) How to access BIOSCI/bionet newsgroup archives. -------------------------------------------------- Back postings of all BIOSCI/bionet newsgroups can be found on the World Wide Web at URL http://www.bio.net/. There are several searchable newsgroup indices at this site. E-mail users can search the BIOSCI archives by using our waismail e-mail server. For instructions send the message help to waismail@net.bio.net. Leave the Subject: line blank (anything entered on the Subject: line is ignored). 4) The BIOSCI user address and research interest directory. ----------------------------------------------------------- Please take this opportunity to add your name, address, and research interest information to the BIOSCI User Address Database if you have not already done so. You can fill out the address form directly through our Web page at URL http://www.bio.net/adrform.html. The address database is reindexed nightly for WWW access (the URL is http://www.bio.net/). If you are not directly on the Internet but can reach it by e-mail, please use our waismail server to access the user directory. waismail use is described above. You can also request a user address form by e-mail from biosci-help@net.bio.net. Please check your database entry from time-to-time to see if your address information is still up-to-date. Because of our limited personnel resources, we ask that you resubmit a *complete* form to revise your entry; we only replace complete entries and do not have resources to edit old forms. Sincerely, Dave Kristofferson BIOSCI/bionet Manager biosci-help@net.bio.net From owner-vectors@net.bio.net Wed Nov 29 22:00:00 1995 Path: biosci!KLAB.AGSCI.COLOSTATE.EDU!dknudson From: dknudson@KLAB.AGSCI.COLOSTATE.EDU ("D.L. Knudson") Newsgroups: bionet.biology.vectors Subject: Mosquito Genomics WWW Server Date: 30 Nov 1995 08:34:24 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 11 Sender: daemon@net.bio.net Distribution: world Message-ID: <30BDDCA3.988@klab.agsci.colostate.edu> NNTP-Posting-Host: net.bio.net The Mosquito Genomics WWW Server (URL http://klab.agsci.colostate.edu/) will be offline from 1700h MST 1 Dec 95 until 0900h MST 4 Dec 95 due to a scheduled power outage. =*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*= Dr. Dennis L. Knudson, Professor of Entomology and Microbiology Department of Entomology Telephone: 970 491-7255 College of Agricultural Sciences Fax: 970 491-0564 Colorado State University Internet:dknudson@lamar.colostate.edu Fort Collins, CO 80523 USA URL http://klab.agsci.colostate.edu/ =*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=