From owner-vectors@net.bio.net Fri Mar 01 22:00:00 1996 Path: biosci!daresbury!yama.mcc.ac.uk!peer-news.britain.eu.net!tank.news.pipex.net!pipex!howland.reston.ans.net!nntp.coast.net!news.sprintlink.net!metro.atlanta.com!nntp.atlanta.com!usenet From: "Mark Q. Benedict" Newsgroups: bionet.biology.vectors Subject: Re: Genetic Educational GIF/educational software Date: Fri, 01 Mar 1996 20:41:11 -0500 Organization: Internet Atlanta Lines: 20 Message-ID: <3137A737.69C7@atlanta.com> References: NNTP-Posting-Host: benedict.atlanta.com Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 2.0GoldB1 (Win95; I) Jay McKeen wrote: > > Anyone know of any ftp sites/WEB sites with gif's, fli's, etc. regarding > genes, chromosome, genetic stuff, for the education of a grade schooler? > > I need some graphic stuff. > > Thanks. > > Jay Jay, Though I'm not sure it would be appropriate for a grade-schooler, you might check out the mosquito mutant web site I recently opened. The images should at least be fun for kids to look at. It can be found, along with other interesting stuff, under the name "Anopheles gambiae Mutant World" at http://klab.agsci.colostate.edu Mark Benedict From owner-vectors@net.bio.net Sun Mar 03 22:00:00 1996 Path: biosci!biosci!not-for-mail From: BIOSCI Administrator Newsgroups: bionet.biology.vectors Subject: VECTOR-BIOLOGY/bionet.biology.vectors is now moderated Date: 4 Mar 1996 15:19:52 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 92 Sender: daemon@net.bio.net Approved: vbmod@klab.agsci.colostate.edu Distribution: world Message-ID: <4hftqo$9on@net.bio.net> NNTP-Posting-Host: net.bio.net The VECTOR-BIOLOGY/bionet.biology.vectors newsgroup has been converted to a moderated forum at the request of the group leader because too many posts were deviating from the newsgroup charter. All messages now are forwarded to the moderator for approval prior to posting. The new charter follows. Sincerely, Dave Kristofferson BIOSCI/bionet Manager biosci-help@net.bio.net Information for VECTOR-BIOLOGY/bionet.biology.vectors (moderated) USENET newsgroup name: bionet.biology.vectors Status: Moderated One line Description: Research on disease vector biology. Moderation address: bionet-biology-vectors@net.bio.net (vect-bio-moderator@net.bio.net is an alias for bionet-biology-vectors@net.bio.net) Moderator: Dennis Knudson Mailing list name: VECTOR-BIOLOGY E-mail addresses: vect-bio@net.bio.net vect-bio@daresbury.ac.uk Newsgroup character: Bionet.biology.vectors is a forum for scientific discussions and a source of information for the community of vector biologists interested in any aspect of vector biology. The name VECTOR-BIOLOGY was chosen to reflect the common interest among scientists working with disease vectors of plants and animals. The purpose of the VECTOR-BIOLOGY newsgroup is to provide a communications forum for biologists, molecular biologists and parasitologists, entomologists, medical specialists, vector control professionals and others involved in the research and control of arthropods which transmit disease to plants and animals. Functions of the newsgroup: The newsgroup will facilitate rapid communication among research scientists and educators using disease vectors in any biological field, including, but not limited to, developmental biology, genetics, physiology, immunology, ecology, taxonomy, evolutionary biology, neuroscience, etc. and will thereby allow more rapid progress in research involving disease vectors. The newsgroup will provide a forum for discussions of problems, old and new ideas, journal publications, and recent developments in vector biology research. The newsgroup will also provide sources of practical advice, methodologies, answers to frequently asked questions concerning vector husbandry and techniques used in vector biology research, and availability of unique reagents for research with disease vectors (e.g., antibodies, cDNAs, primers and gene sequences, DNA libraries, mutants, etc.). Finally, the newsgroup will serve as a bulletin board for announcements of meetings, conferences, job opportunities, and funding sources of interest to biologists studying disease vectors. Subscribers are welcome from universities or any academic institutions, government agencies, hospitals and other medical institutions, and industrial or commercial organizations. Contributions within the functions outlined above are encouraged. Moderation Policy: Mass-posted commercial messages, chain letters, and similar postings not germane to vector biology will be deleted without comment. Inapropriate messages posted in good faith will be returned to the sender. Messages not strictly within the charter but likely to be of interest to many subscribers will be accepted. Dr. Dennis L. Knudson Professor of Entomology and Microbiology Department of Entomology College of Agricultural Sciences Colorado State University Fort Collins, CO 80523 USA Internet:dknudson@lamar.colostate.edu URL http://klab.agsci.colostate.edu/ From owner-vectors@net.bio.net Tue Mar 05 22:00:00 1996 Path: biosci!biosci!not-for-mail From: graciela panzetta Newsgroups: bionet.biology.vectors Subject: PCR in Aedes Date: 6 Mar 1996 04:34:54 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 19 Sender: daemon@net.bio.net Approved: vbmod@klab.agsci.colostate.edu Distribution: world Message-ID: <4hk0pe$t4a@net.bio.net> NNTP-Posting-Host: net.bio.net To whom may concern Hello! I'm very pleased to join the VECTOR-BIOLOGY newsgroup. I'm a molecular biologist working in colaboration with Dra. Gardenal in Aedes albifasciatus population genetics. We are looking forward to amplify mtDNA of Aedes albifasciatus with the following primers TL2-J-3037 (alias A-t-LEU): ATGGCAGATTAGTGCAATGG C3-N-5460 (alias CO 3b): TCAACAAGTGTCAGTATCA We should like to know if these primers have already been used in these genera? Otherwise, is there other pair of primers suitable for mtDNA PCR/RFLP? THANKS IN ADVANCE FOR YOUR HELP! From owner-vectors@net.bio.net Wed Mar 06 22:00:00 1996 Path: biosci!biosci!not-for-mail From: John VanDyk Newsgroups: bionet.biology.vectors Subject: Postdoctoral position available Date: 7 Mar 1996 08:07:32 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 22 Sender: daemon@net.bio.net Approved: vbmod@klab.agsci.colostate.edu Distribution: world Message-ID: <4hn1k4$sg@net.bio.net> NNTP-Posting-Host: net.bio.net POSTDOCTORAL POSITION AVAILABLE ------------------------------- The medical entomology laboratory at Iowa State University is seeking a postdoc. Preferred research areas include arboviruses, neuromodulation of mosquito flight activity, and the effects of pathogens on flight behavior. Responsibilities include providing significant contribution to an innovative program of research, as well as the summer arbovirus surveillance program and overseeing mosquito rearing. Principal investigator in the medical entomology laboratory is Dr. Wayne A. Rowley (http://www.ent.iastate.edu/dept/faculty/rowley.html). Dr. Rowley will be attending the annual AMCA meeting in Norfolk. For more information, contact him by e-mail (rowley@iastate.edu). -- -- John VanDyk, Dept. of Entomology Internet: jvandyk@iastate.edu -- 436 Science II, Iowa State Univ., Ames IA 50011 (USA) Phone 515-294-4387 http://www.public.iastate.edu/~jvandyk/ FAX 515-294-5957 +++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Ask me about Mosquito-L, the mosquito electronic mailing list! From owner-vectors@net.bio.net Mon Mar 18 22:00:00 1996 Path: biosci!biosci!not-for-mail From: administrator Newsgroups: bionet.biology.vectors Subject: NEW MALARIA THERAPY Date: 19 Mar 1996 15:23:30 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 5 Sender: daemon@net.bio.net Approved: vbmod@klab.agsci.colostate.edu Distribution: world Message-ID: <4infli$djh@net.bio.net> NNTP-Posting-Host: net.bio.net Visit following homepage http://www.sowatel.be/tp/malaria From owner-vectors@net.bio.net Tue Mar 19 22:00:00 1996 Path: biosci!biosci!not-for-mail From: Dennis L. Knudson Newsgroups: bionet.biology.vectors Subject: TDR WorkPlan96: ENVIRONMENT Date: 20 Mar 1996 06:25:34 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 240 Sender: daemon@net.bio.net Approved: vbmod@klab.agsci.colostate.edu Distribution: world Message-ID: <4ip4gu$d6h@net.bio.net> NNTP-Posting-Host: net.bio.net I enclosed the following and trust that the tdr-scientists list will not mind. ------------- Begin Forwarded Message ------------- From owner-tdr-scientists@sun1.who.ch Tue Mar 19 16:50 MST 1996 Date: Tue, 19 Mar 96 17:54:56 CET From: hatak@who.ch To: TDR-Scientists@who.ch Cc: agbayanim@who.ch, gomesm@who.ch Subject: TDR WorkPlan96: ENVIRONMENT The UNDP/World Bank/WHO Special Programme for Research & Training in Tropical Diseases TDR WORKPLAN of the TASK FORCE FOR TROPICAL DISEASES AND THE ENVIRONMENT Rationale In vector borne diseases, a change in risk of the disease can come as an unintended result of economic activities or policies. Even small variations in local microclimate can affect an insect vector's chances of survival, and therefore the disease transmission potential within a given area. Consequently, understanding and predicting the effects of environmental change on tropical diseases is crucial for their control. Disease transmission is influenced in a complex way by interrelated factors such as local temperature, air humidity, rainfall patterns, altitude, vegetation density, tree species composition and spacing, soil structure, patterns of crop cultivation, maintenance and harvesting, as well as the stability, immunity, mobility and behaviour of local human populations. In some geographical areas, deforestation can pave the way for the spread of disease. In other areas, reforestation is a contributor to risk. These and other human inroads into fragile ecosystems often pose a dilemma of how to reconcile the often life-saving benefits of economic growth with the risk of increased disease it may ultimately carry. The dilemma is often acutely illustrated by the provision of water which may be needed for drinking or irrigation (for agricultural production) but which can inadvertently offer breeding places for mosquitos, sandflies and snails which transmit malaria, leishmaniasis and schistosomiasis. The Environment Task Force focuses on predicting and quantifying the changes in disease risk associated with environmental change, and quantifying the health benefits and costs in economic terms. In view of the regional importance of specific malaria vectors, a high priority has been allocated to the development of proposals from sites representing geographical zones which are of strategic importance to the disease and where major environmental changes are in force. Armed with empirical data on correlations between environmental change and impact of tropical diseases, The Task Force influences agricultural development policies - so that the design of these development projects can be improved to take into account the associated health benefits and costs. One of the most useful things tropical disease research can be predicting how, why and where disease risks increase, and implementing control measures to minimise these risks in advance of increased transmission. Objectives 1. to quantify the relationship between land use changes and risk of malaria or other tropical diseases in areas undergoing sustained environmental change, and to test interventions to reduce negative impacts. 2. to quantify the health benefits and costs of development projects in economic terms 3. to influence major institutions financing development projects (in agriculture and water) to include health impact assessments routinely in their appraisal, particularly in circumstances where a negative impact is predictable from (1) above. Expected Outcomes With respect to objective 1, two crucial projects have been funded - one in SE Asia which has the highest rates of multi-drug resistance in the world, and one in Africa which has the highest mortality rates for malaria. Interim data for the SE Asian project on the extent to which specific commercial tree plantation in South East Asia are highly associated with malaria risk and why will be available in February 1996, final data is expected towards end 1996, early 1997. At that point, the project results will be presented to the agricultural sector, and development banks financing agricultural-tree crop plantations within the region so as to influence their management policies in relation to these tree crop plantations. Also with respect to objective 1, researchers in dryland Ethiopia are studying the extent to which reforestation and water harvesting for increased food production can change the risk from seasonal to perennial malaria, and leads to an increased risk of schistosomiasis infection. Baseline, cross-sectional data collected during peak transmission shows that overall malaria prevalence in households near the water and forest interventions are eight times greater than comparable households not near the interventions; prevalence is seventeen times higher in children under ten in the intervention households than the non intervention households. Thus there is a sound basis for examining whether incidence of disease throughout the year is consistently higher in the intervention groups. Data to confirm or refute this hypothesis will be collected during 1996-7. Influencing project appraisal at The World Bank is a major focus of the Task Force activities. Therefore, with respect to objective 2, the Task Force has involved economists at The World Bank Environment Policy Research Department to quantify - in economic terms - the costs and benefits of the water/reforestation development, taking into account the health impact (which on the benefits side includes food security, and on the cost side is likely to involve higher morbidity and death from malaria). The economic research has benefited from quantitative epidemiological data collected in the Ethiopian project which is a critical example of the impact of environmental change on malaria in Africa. Possibilities for Collaboration in Workplan Activities As indicated in the attached table, many of the activities in the workplan are already underway, and the Task Force is not inviting new research proposals on these particular topics. However, during 1996 a major new activity on highland malaria in Africa will be launched for which the Task Force will seek the collaboration of investigators from disease endemic countries. In the increasingly deforested highlands of East Africa, malaria appears to be emerging as a result of small rises in temperature enhancing the rate of development and activity of vectors and parasites. For example, the Usambara mountains of Tanzania were considered to be free from malaria. However a recent study has suggested that malaria is now more common at the top of these mountains than previously thought; the montane rainforest which previously covered the Usambara mountains has in parts been replaced by forests of exotic species but there is overall much less forest cover than before. The deforestation has increased local area temperatures, provided the open ground and numerous small water bodies favoured by the local malaria vector, and incidence of malaria appears to have increased. Similar histories apparently apply to the rift valley region of Kenya. The Task Force is therefore soliciting proposals to examine this issue more closely. A crucial element of such research will be the design of the proposals - the reliability of historical data in research involving historical controls, case-control comparisons within geographical areas would need to control for potential confounders, and interventions may not be feasible. However, a great deal of work is being done on this issue, and to examine current research and fund gaps in this research, the Task Force will be holding a workshop in April-May 1996 to develop proposals on this issue. How to apply Proposals on the above issue are invited before 1 May 1996, to be reviewed and recommended for funding in early June 1996. A brochure on the Task Force is available . The brochure and TDR application forms are available from Communications, WHO/TDR, 1211 Geneva 27, Switzerland, Fax:(41) 22-791-4854 . Email: tdrnews@who.ch Proposals should be submitted before the deadline to Dr M. Gomes, WHO/TDR at the same address. --------------------- WorkPlan in List format follows ------------ OBJECTIVES PLANNED ACTIVITIES ---STATUS Objective 1: quantifying the relationship between land use changes and risk of malaria /other tropical diseases, and testing interventions Correlation between malaria incidence and changes in vegetation cover SE Asia ---Funded. Interim results available Feb 1996; final results end 1996-early 1997 3 yr project funded directly by Sida. Impact of irrigation+ reforestation on malaria in Africa (dryland Ethiopia) ---Baseline data available. Interim data expected early 1997 impact of new species of coffee tree on case incidence of cutaneous leishmaniasis in Colombia ---funded 1994. Project delayed. To be re-started in 1996. intervention to reduce breeding in irrigation wells in Myanmar ---Project funded Dec 1995. For completion 1997-8 the impact of deforestation on savanna vectors responsible for river blindness ---Funded. Results expected June 1996. highland malaria in Africa - effects of deforestation + other land use changes on malaria ---Workshop planned to develop proposals, April 1996. Objective 2: quantifying the health benefits and costs of development projects in economic terms Economic valuation of impact of irrigation+reforestation in Ethiopia - effect of malaria on production Economic valuation of impact of irrigation+reforestation in Ethiopia - willingness to pay approach ---Both projects simultaneously funded 1995. In collaboration with World Bank - Environment Policy Research Department and Division of Land Water & Natural Habitats. Objective 3: influencing major institution financing development projects in agriculture Planned visit to FAO, Rome in 1996 with preliminary results of SEAsia project, and Ethiopia project. ---Planned first half 1996, either March or May 1996 Planned visit to World Bank late 1996 or early 1997. (environm.txt)vbb.19mar96  ------------- End Forwarded Message ------------- From owner-vectors@net.bio.net Wed Mar 20 22:00:00 1996 Path: biosci!biosci!not-for-mail From: Asa Gylfe Newsgroups: bionet.biology.vectors Subject: tick rearing and feeding Date: 21 Mar 1996 05:58:42 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 34 Sender: daemon@net.bio.net Approved: vbmod@klab.agsci.colostate.edu Distribution: world Message-ID: <4irnai$7s3@net.bio.net> NNTP-Posting-Host: net.bio.net Hello I am trying to rear Ixodes uriae ticks in a laboratory. The purpose is to study I.uriae as a possible vector of Lyme dissease Borrelia. I have some problems whith the "tick farm": Temperature Moisture Mould Fridge temperature seems better than roomtemperature. But the eggs dont hatch. Moist soil seems better than glass bottles in a moistchamber containing saturated MgSO4- water solution (too dry). The mould problem was not solved by spraying amphotericinB. My ticks are slowly dying!!!!!! If you have any suggestions that could help, please contact me!! I also intend to attach the ticks on mice and birds. In a previous experiment, the ticks refused to bite mice. Is there any good method of attaching ticks to an animal? I would be thankful for your comments Asa Gylfe dep. of microbiol. Umea University Sweden ENDS. From owner-vectors@net.bio.net Wed Mar 20 22:00:00 1996 Path: biosci!biosci!not-for-mail From: Sidney E. Grossberg Newsgroups: bionet.biology.vectors Subject: CDC Advisory Date: 21 Mar 1996 09:29:58 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 59 Sender: daemon@net.bio.net Approved: vbmod@klab.agsci.colostate.edu Distribution: world Message-ID: <4is3mm$tr@net.bio.net> NNTP-Posting-Host: net.bio.net The CDC has requested that the following advisory be issued to all members of ASV in light of recent disturbing events involving requests for shipment of dangerous biological agents to "questionable" recipients: 11 March 1996 Center for for Disease Control and Prevention (CDC) In recent years, the threat of terrorist activity involving the use of biological agents has raised increasing concern from the perspective of both public health and national security. Accordingly the Centers for Disease Control and Prevention (CDC) has serious concerns about the illicit use and the interstate transportation of certain human pathogens that could have adverse consequences for human health and safety. To immediately address this issue, CDC requests that all those who authorize the acquisition and transfer of dangerous human infectious agents, increase their vigilance to minimize the risk of illicit access to infectious agents by: 1) reviewing all requests prior to transferring pathogens and toxins, particularly any request regarding the agents of causing anthrax, botulism, brucellosis, plague, Q-fever, tularemia, and any agents classified for work at Biosafety Level 4; 2) determining whether agents will be used for legitimate medical or scientific purposes; and 3) immediately reporting any suspicious inquiries or transactions to CDC's Office of Health and Safety, at (404) 639-3235 (nights and weekends, call the CDC Duty Officer at 404-639-2888). These voluntary safeguards are a first step toward strengthening regulatory and statutory protections. CDC co-chairs a Federal interdepartmental working group that is developing a framework for controlling the acquisition and transfer of infectious agents. This framework will include safeguards to control access to microbial agents of particular concern while ensuring that researchers and others who have a legitimate scientific need for these agents have appropriate access to them. This approach will require close collaboration among researchers, their institutional biosafety officials and committees, and providers of these agents. CDC will soon be proposing new regulations regarding acquisition and transfer of certain biological agents. The regulations will be developed with input from professional associations, the research community, law enforcement authorities, and concerned members of the public. A Notice of Proposed Rulemaking will be published in the Federal Register for public review and comment in approximately 120 days. In addition, the Department of Justice is working to strengthen relevant criminal statutes to enable prosecution of those who attempt to gain illicit access to these agents. Sincerely, David Satcher, M.D., Ph.D. Director Centers for Disease Control and Prevention (CDC) ------------- End Forwarded Message ------------- From owner-vectors@net.bio.net Wed Mar 20 22:00:00 1996 Path: biosci!biosci!not-for-mail From: Dennis L. Knudson Newsgroups: bionet.biology.vectors Subject: TDR WorkPlan96: PATHOGENESIS Date: 21 Mar 1996 08:41:18 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 350 Sender: daemon@net.bio.net Approved: vbmod@klab.agsci.colostate.edu Distribution: world Message-ID: <4is0re$p3n@net.bio.net> NNTP-Posting-Host: net.bio.net ------------- Begin Forwarded Message ------------- From owner-tdr-scientists@sun1.who.ch Thu Mar 21 08:41 MST 1996 Date: Thu, 21 Mar 96 13:15:37 CET From: hatak@who.ch To: TDR-Scientists@who.ch, bergquistn@who.ch Cc: agbayanim@who.ch Subject: TDR WorkPlan96: PATHOGENESIS UNDP/World Bank/WHO Special Programme for Research and Training in Tropical Diseases (TDR) WORKPLAN of the PATHOGENESIS COMMITTEE Rationale The Committee on Pathogenesis was created to facilitate a horizontal orientation towards basic research on the pathogenesis of malaria, schistosomiasis, lymphatic filariasis /onchocerciasis, leishmaniasis, African trypanosomiasis and Chagas' disease. Based on the notion that concerted thrusts in key areas of parasite-host relations constitute the most likely way towards breakthroughs, research is focused on mechanisms of protective immunity and host pathology including cytokine responses, identification of drug and vaccine targets, elucidation of gene regulation in the parasite, and the development of model systems which would facilitate research of importance for the control of one or more of the TDR target diseases. Objectives The Pathogenesis Committee encourages research in areas perceived as of basic importance in the host-parasite relationship with an emphasis on mechanisms which lead to clinical disease in the host and those which are essential for parasite survival. Applicants are invited to develop proposals dealing with the following questions: ( 1) environmental and other factors affecting the character of immune responsiveness and pathology and elucidation of the mechanisms of action (2) parasite antigen variation and its role in pathology and immune evasion (3) infective and pathologic role of purified vector-specific molecules delivered together with the parasite at the time of infection (4) pathology mediated by direct parasite action as opposed to immune-mediated lesions (5) differential expression and interplay of cytokines in response to parasite invasion (6) polymorphic markers within parasite DNA which can be amplified by PCR to permit analysis of phylogeny, genealogy and genetic variation; (7) host genetic factors affecting the character of immune responsiveness and associated pathology; (8) use of disrupted gene mutants for the study of mechanisms of biochemical pathways, drug resistance and virulence factors and identification of genes amenable to screening systems in this connection; ( 9) use of genetically altered animals and/or vectors for the study of the function and regulation of genes of interest: (10) development of reliable transformation systems and stable, attenuated parasite lines (in the case of helminths, particularly important cell lines). Highlights of progress - The pigment-mediated toxicity in malaria and the nitric oxide synthase enzyme of parasitized erythrocytes, including the causative factor, have been identified. - A cDNA sequence encoding the trypanosome-derived lymphocyte triggering factor (TLTF) has been shown to express a protein with the capacity of triggering CD8+ but not CD4+cells and evidence for TLTF activity in trypanosomes infective for humans has been demonstrated. - Trypanosoma cruzi transformants were obtained by inserting, into COS7 cells under selective pressure, the VSG sequence with the site of anchor attachment converted to the corresponding mammalian sequence. - A mechanism for interference with parasite development was shown in a T. cruzi model by confirming that UDP-Glc-glycoprotein glycosyltransferase only glucosylates misfolded proteins which are then retained in the endoplasmic reticulum by lectin-like anchors. - Vaccination with filarial chitinase has been shown to result in a protective effect, directed at microfilariae but not adult worms, which is due to the chitinase itself and not to the maltose binding protein (MBP) moiety. - Progress has been made on the characterization of the spliced leader (SL) RNA-specific methyl transferases in Trypanosoma brucei. - The trypanolytic domain of a TNF-gamma-like trypanolytic protein from the earth worm Eisenia foetida has been identified and shown to kill 100% of T. brucei trypanosomes in one hour, whilst only weakly affecting mammalian cells. - Research on the obstruction of P. falciparum-mediated cytoadherence of infected erytrocytes has produced a construct containing the extracellular hinge domains of a soluble chimeric human CD36-IgG1. - In T. cruzi, the calmodulin-ubiquitin (CUB) genes have been shown to be are required not only for viability but also for virulence. - Stable integration of exogenous plasmid DNA into homologous sites on rodent P. berghei has been achieved. - Progress has been achieved in the work towards a SCID mouse model transgenic for the urokinase gene and in developing conditions under which human hepatocytes can be inserted to serve as hosts for schizogony. - The project aiming to develop the P. gallinaceum model into an avirulent auxotrophic organism has so far defined putative 5' and 3' elements involving gene expression whilst, in the P. falciparum system, new DHFR/TS mutations have been produced and tested for enzyme activity and inhibition by drugs. Possibilities for Collaboration in Workplan Activities Research proposals with budgets up to US$ 50,000 addressing one of the objectives mentioned above are invited. Projects are funded for two years after which investigators are invited to reapply, either for a continuation or for a new line of research. At this point, competitive proposals are encouraged to assure continuation of particularly interesting research leads but the Committee will not fund parallel work at different institutions. Interested investigators should consult with the Committee manager before applying. How to apply Researchers interested in collaborating in the above mentioned activities should request application forms from the Communications department of TDR. Proposals for 1996 should be submitted by 23 July. All specific correspondence related to research covered by the Pathogenesis Committee should be sent to Dr N.R. Bergquist Manager of the Pathogenesis Committee UNDP/World Bank/WHO Special Programme for Research and Training in Tropical Diseases (TDR) World Health Organization, 20 Avenue Appia, CH-1211 Geneva 27, Switzerland Tel: (41.22) 791.3864/3863 Fax: (41.22) 791.4854 E-mail: Bergquistn@WHO.CH -----------------------WorkPlan in list format follows----------------- STRATEGIC RESEARCH WORKPLAN - Committee on Pathogenesis Objectives Planned Activities ---Status Pathogenic mechanisms Work on the role of adhesion molecules, triggering factors and cell receptors in malaria and African trypanosomiasis ---IIIQ94-IQ97, [3rd Quarter 94 - 1st Quarter 97] Elucidation of cellular signalling leading to protective responses in leishmaniasis, trypanosomiasis and malaria ---IIIQ94-IQ97 Unravelling the mechanisms causing brain microvascular changes in malaria ---IIIQ94-IQ97 To define the basis of malaria resistance in vitro with reference to attachment and invasion of the parasite into the erythrocyte and intracellular parasite growth ---IIIQ95-IQ97 To identify immunoglobulin-binding domain(s) of rosettins in malaria by transfection and sequence comparisons ---IIIQ95-IQ97 To test the hypothesis that during malaria in pregnancy the immune system is redirected from a Th2 response since it is detrimental to the developing foetus and placenta ---IIIQ95-IQ97 To define immune responses, cytokine and tissue changes in the brains of vervet T. rhodesiense infected monkeys ---III95-IQ97 To characterize the mechanism by which egg antigens plus IL-12 reduces fibrosis in schistosomiasis ---IIIQ95-IQ97 To investigate the physio-pathological impact of antifibrotic treatment on hepatic circulation and resolution of hepatic lesions in experimental schistosomiasis ---IIIQ95-IQ98 Drug/Vaccine targets Identification of target methyltransferases in African and American trypanosomes and Leishmania ---IIIQ94-IQ97 Production of all possible DHFR mutants in P. falciparum and testing inhibitors binding to various side chain replacements ---IIIQ94-IQ97 Development of a synthetic peptide filarial vaccine based on protective epitopes on microfilarial chitinase ---IIIQ94-IQ97 Study of the effect of disrupting the T. cruzi glycoprotein glycosyltransferase gene in comparison with the impact of glucosidase inhibitors on parasite infectivity and survival ---IIIQ94-IQ97 Development of genetically defined lines of trypanosomes and Trypanosome Lytic Factor (TLF). Establishment of the genetic basis for TLF resistance ---IIIQ95-IQ97 To identify and characterize P. falciparum proteases and the encoding genes ---IIIQ95-IQ97 Cytokine responses Study of the antigen-induced cytokine responsiveness in children born to mothers with and without filariasis ---IIIQ94-IQ97 Molecular characterization of the tumour necrosis factor and its role and its relation to interferon-gamma in immune responses to African trypanosome infection ---IIIQ94-IQ97 Identification of ways of directing the immune system towards either a Th1 or a Th2 type response in leishmaniasis and oriental schistosomiasis ---IIIQ94-IQ97 To study specific cytokines in granuloma formulation in schistosomiasis using transgenic mouse models and to determine the major endothelial cell adhesion molecules required for cell recruitment ---IIIQ95-IQ97 Gene regulation Study of the impact of virulence genes in T. cruzi and how they can be modulated ---IIIQ94-IQ97 Identification of target transamidase proteins in T. cruzi by the generation of mutant epimastigotes using target gene disruption and transfection ---IIIQ94-IQ97 To utilize a dominant-negative mutant of receptor-coupled adenylate cyclase RAC-A to study the biological function of this receptor in the life cycle of Leishmania ---IIIQ94-IQ97 Development of an avirulent auxotrophic malaria parasite strain by genetic engineering ---IIIQ94-IQ97 To assess for sequence polymorphisms of cDNAs encoding the autoantigen-like proteins from the two strains of O.volvulus ---IIIQ95-IQ98 Model systems Development of a stable transfection system for malaria parasites ---IIIQ94-IQ97 Production of immortalized schistosome cell lines to replace laboratory life cycles ---IIQ95-IIIQ97 Development of a SCID mouse model system which would permit the study of P. falciparum schizogony in human hepatocytes ---IIIQ94-IQ97 To establish a schistosome DNA transformation system to study gene expression in this organism not approachable to conventional genetics ---IIIQ95-IQ98 Establishment of a laminar flow assay system for the study of modulation of cytoadherence of P. falciparum-infected erythrocytes under flow conditions by cytokines, soluble mediators and pharmacological agents ---IIIQ95-IQ98 To develop Leishmania-specific expression vectors to minimize the risk of spreading drug/resistance ---IIIQ95-IQ97 To develop new genetic tools for positive and negative genetic selection schemes for asexual stages of P. falciparum ---IIIQ95-IQ97 (patho96.txt)vbb.21mar96  ------------- End Forwarded Message ------------- From owner-vectors@net.bio.net Wed Mar 20 22:00:00 1996 Path: biosci!biosci!not-for-mail From: Dennis L. Knudson Newsgroups: bionet.biology.vectors Subject: TDR WorkPlan96: MACROFIL Date: 21 Mar 1996 08:41:08 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 364 Sender: daemon@net.bio.net Approved: vbmod@klab.agsci.colostate.edu Distribution: world Message-ID: <4is0r4$p31@net.bio.net> NNTP-Posting-Host: net.bio.net ------------- Begin Forwarded Message ------------- From owner-tdr-scientists@sun1.who.ch Thu Mar 21 08:48 MST 1996 Date: Thu, 21 Mar 96 13:12:55 CET From: hatak@who.ch To: TDR-Scientists@who.ch, gingerc@who.ch Cc: agbayanim@who.ch Subject: TDR WorkPlan96: MACROFIL UNDP/World Bank/WHO Special Programme for Research and Training in Tropical Diseases (TDR) 1996 WORKPLAN of the STEERING COMMITTEE on MACROFILARICIDAL DRUGS FOR ONCHOCERCIASIS AND LYMPHATIC FILARIASIS (MACROFIL) Background: The objectives of the Programme are to discover adulticidal (macrofilaricidal) drugs for onchocerciasis and lymphatic filariasis with the following profile:  Effective (>70% Kill);  Safe (for community use with limited medical supervision);  Acceptable dosing regimen (oral dosing over no more than 3 days, or single intramuscular injection);  Long shelf life (>2 years at ambient temperatures). The value to the patient of such drugs would be:  Permanent removal of the source of pathology (Microfilariae in onchocerciasis; adult worms in lymphatic filariasis);  Removal of need to take ivermectin continuously. The value to the community is:  Control or elimination of transmission; sustaining and consolidating OCP's achievements to date in onchocerciasis control;  Elimination of needs for, and costs of, continuous ivermectin treatment;  Reduction in the likelihood of acquired resistance to ivermectin;  An alternative to larviciding, which is no longer an affordable option;  Providing a fully effective adulticidal drug to replace diethylcarbamazine in lymphatic filariasis. Current Activities: Two complementary strategies are being followed to discover new lead molecules:  Characterization and validation of potential drug targets in filariae, leading to rational, computer-aided design, or identification of novel ligands by interaction with parasite receptors;  In vivo assays (against B. pahangi and A. viteae in the gerbil) of novel molecules obtained from as wide a range of novel compounds as possible. Two compound screening centres are currently supported for these activities. Once active molecules are identified, chemical synthesis may be supported when analogues are not available, to optimize promising leads. Secondary evaluation of potential drugs is carried out using B. pahangi in the dog, and once pharmacokinetic results are available, against O. ochengi in cattle. Preclinical studies (Bulk chemical synthesis, analysis, formulation, pharmacokinetics, toxicology, etc.) are contracted out to specialist laboratories, but at present the programme supports two general drug assay/pharmacokinetics laboratories. Similarly, clinical studies in onchocerciasis and lymphatic filariasis are carried out by a network of centres in endemic countries. Proposals for collaboration in any of the above activities are welcomed. Objectives Completed in 1995 1. Amocarzine. Phase I clinical trials initiated in India. 2. Amocarzine. Extended Phase II clinical trials, using 3 mg/kg post-prandially twice a day for 3 days against onchocerciasis, initiated in Ghana. 3. Suramin clinical trial completed in Nigeria. Sera analyzed for secondary parameters of macrofilaricidal action. 4. Two new drug analytical laboratories established and validated for GLP. 5. Mutagenicity studies completed on compounds 129577, 251993 and 105666. 6. Separation of enantiomers of UMF 078 by chiral column technology. Efficacy studies initiated. 7. Efficacy studies of Lilly 269019 against B. pahangi in dog completed. 8. Work on ivermectin resistance probes reviewed and research programme modified. 9. Revision of centralized compound database and programme modifications initiated. 10. Review of molecular targets in filariae suitable for high throughput screening. Financial support for this programme currently comes from both TDR and the Onchocerciasis Control Programme in West Africa, although the latter will be phased out at the end of 1997, when Macrofil will continue as a TDR programme. All correspondence on Macrofilaricidal drugs for Onchocerciasis and Lymphatic Filariasis should be sent to: Dr Colin Ginger, Manager Steering Committee on Macrofilaricidal Drugs for Onchocerciasis and Lymphatic Filariasis Special Programme for Research and Training in Tropical Diseases (TDR) World Health Organization 20, Avenue Appia CH-1211 Geneva 27, Switzerland Telephone: (41-22) 791.38.18 Facsimile: (41-22) 791.48.54 Email: Gingerc@who.ch --------------------- WorkPlan in list format follows--------------- WORKPLAN - PRODUCT RESEARCH AND DEVELOPMENT: CHEMOTHERAPEUTICS 6 February 1996 STEERING COMMITTEE ON MACROFILARICIDAL DRUGS FOR FILARIAL DISEASES (MACROFIL) (Manager C. Ginger) Major Thrust Specific Activities ---Status CLINICAL: A. Development of Amocarzine as a macrofilaricide for onchocerciasis. 1. Phase 2 study in Africa for safety, tolerance and efficacy (OCRC), using a dose of 3mg/kg pp, bid, for 3 days. ---In Progress; Report: Q4, 1996 (i.e. 4th Quarter 1996) 2. Phase 3 study (if justified by Phase 2 results). Multi-centre study with ivermectin as comparative drug. ---To begin Q1, 1997 Report: Q4, 1998 3. Submission of reports to regulatory authorities. ---1999 B. Development of Amocarzine as a macrofilaricide for lymphatic filariasis. 1. Phase 1 study in India. Safety, tolerance and pharmacokinetics. ---In Progress; Report; Q2, 1996 2. Phase 2 study in India (if justified by Phase 1 results). ---To begin: Q2, 1996 Report: Q3, 1996 3. Phase 3 study (if justified by Phase 2 results). ---To begin Q1, 1997 Report: Q3, 1998 4. Submission of reports to regulatory authorities. ---1999 C. Maintain and identify clinical centres in endemic areas 1. As above ---Ongoing PRECLINICAL: D. Development of UMF 078 as a macrofilaricide. 1. Chemistry and formulation.  File and maintain patents; ---Ongoing  Separate enantiomers; ---Ongoing. Needs scaleup  Formulation and analysis of dosage forms ---Ongoing 2. Efficacy.  Against O. ochengi in cattle; ---Ongoing; Results: Q3, 1996  Determine efficacy of enantiomers (Rodent model). ---Ongoing 3. Pharmacokinetics & metabolism.  Decision on oral versus intramuscular routes; ---Q2, 1996  Design & contract out of radio labelled study. ---To begin Q2, 1996 4. Toxicology.  Acute toxicity studies in rat; ---To begin Q2, 1996  Irritancy at injection site; ---To begin Q2, 1996  28-day toxicity studies in rat & dog. ---To begin Q3, 1996 5. Preparation of CTX/IND of preclinical results for possible Phase 1 clinical trials. ---Q2, 1997 SECONDARY DRUG TESTING E. 1. Thiadiazole - 129577.  Efficacy and pharmacokinetics in calves and infected cattle (O. ochengi). ---Ongoing; Results: Q3, 1996 2. Bishydrazone - 251993.  Efficacy and pharmacokinetics in calves and infected cattle (O. ochengi); ---Ongoing; Results: Q3, 1996  New analogues. ---In preparation 3. Trifluoromethylguanidinopyrimidine - 105666  Pharmacokinetics in calves. ---Ongoing; Results: Q2, 1996  Efficacy and pharmacokinetics in infected cattle (O. ochengi) ---To begin; Q3, 1996. Results: Q1, 1997 4. Lilly 269019.  Analogues from Lilly - efficacy ---Ongoing 5. Mutagenicity studies on compounds above. ---In progress; Results: Q1, 1996 F. Development of assays for promising compounds 1. See D & E above. Two analytical centres operative. ---Ongoing DRUG DISCOVERY: G. Utilize predictive compound screening assays to identify potential macrofilaricides. 1. In vivo assay of compounds against: a) transplanted adults of B. pahangi & A. viteae in gerbils; ---Ongoing in 2 centres b) B. pahangi in dogs; ---Ongoing c) O. ochengi in cattle. ---Ongoing 2. Develop and maintain computer data base. ---Ongoing. Operative Q2, 1996 H. Identify & obtain potential lead molecules for assay. 1. Ensure continuous supply of compounds; ---Ongoing 2. Maintain awareness of novel drugs and molecules via scientific and patent literature. ---Ongoing 3. Contact potential suppliers and negotiate screening & development agreements; ---Ongoing 4. Maintain chemical repository & shipping centre. ---Ongoing I. Identify novel drug targets in filariae. 1. Characterize, clone, express and purify, potential drug targets from filariae and isofunctional mammalian systems; ---Ongoing 2. Develop high throughput assays for identified drug targets in collaboration with established laboratories. ---Ongoing 3. Test compounds in established screens. ---Ongoing IVERMECTIN RESISTANCE: J. Develop molecular probes able to detect early resistance to ivermectin in O. volvulus. 1. Characterization of mechanisms of resistance to ivermectin in free living and parasitic nematodes. ---Ongoing 2. Cloning of ivermectin resistant genes from resistant nematodes. ---Ongoing 3. Develop techniques to identify resistant genes in Onchocerca. ---Ongoing; Results Q4, 1998 (macrofil.tx2)vbb.21mar96  ------------- End Forwarded Message ------------- From owner-vectors@net.bio.net Wed Mar 20 22:00:00 1996 Path: biosci!biosci!not-for-mail From: Dennis L. Knudson Newsgroups: bionet.biology.vectors Subject: TDR WorkPlan96: MOLECULAR ENTOMOLOGY (fwd) Date: 21 Mar 1996 06:00:02 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 314 Sender: daemon@net.bio.net Approved: vbmod@klab.agsci.colostate.edu Distribution: world Message-ID: <4irnd2$802@net.bio.net> NNTP-Posting-Host: net.bio.net Forwarded with permission of listserver manager. ---------- Forwarded message ---------- Date: Wed, 20 Mar 96 18:09:20 CET From: hatak@who.ch To: TDR-Scientists@who.ch, dobrokhotovb@who.ch Cc: agbayanim@who.ch Subject: TDR WorkPlan96: MOLECULAR ENTOMOLOGY UNDP/World Bank/WHO Special Programme for Research and Training in Tropical Diseases (TDR) WORKPLAN of the MOLECULAR ENTOMOLOGY COMMITTEE Rationale Malaria is on the increase in many areas of the world and novel, sustainable approaches to its control are urgently needed. While a variety of effective vector control methods are available for the interruption of malaria transmission, some of which have been successfully used in tropical disease control programmes, classical vector control methods have significant limitations for wide application. These include vector resistance to many contemporary pesticides, as well as their high cost, adverse ecological effects and environmental pollution. Recent biotechnological advances in the area of the host-parasite relationships and vector genetics suggest the possibility of revolutionary methods for malaria control. The ultimate goal of this research would be the genetic modification of anopheline vectors in order to disrupt the parasite cycle. There are many problems to overcome and the time needed to achieve this goal will be at least ten to twenty years. However, it is considered important that intermediate steps of this research may be themselves of practical use for field entomology and epidemiology studies. Objectives The general objectives of the Molecular Entomology Committee are to develop tools for genetically altering the vector competence of a natural population of Anopheles mosquitoes to interrupt malaria transmission. The steps necessary for the engineering and release of a refractory (malaria non-competent) mosquito involve the solution of various laboratory and field problems such as: (1) understanding the molecular basis of vectorial resistance to the malaria parasite - genetic, molecular and physioethological studies of vector parasite interactions; Midgut, Hemolymph and Salivary gland targets for disruption of Plasmodium growth. (2) the development of genetic and molecular tools for engineering a mosquito resistant to malaria - Genome mapping of Anopheles gambiae chromosomes; Selectable markers for mosquito transformation; Characterization of tissue specific promoters and development of germ line transformation methods. (3) understanding mosquito population dynamics, in order to be able to apply these new methods effectively in the field - Gene flow and mating barriers between Anopheles populations; Gene driver systems (transposons, bacterial and viral symbionts). (4) Mosquito olfaction systems - genetic and ethological studies of chemosensory mechanisms of host-finding behaviour. Progress and Expected Outcomes: After a few years of research supported by TDR in close collaboration with MacArthur Foundation and Wellcome Trust, significant progress has been achieved on all the above-mentioned subjects. Therefore, it was shown that Molecular entomology approach for Malaria control is feasible and the goals can be achieved in the foreseeable future. 1. Research on dominant and semidominant markers for the identification of transgenic mosquitos led to the discovery and cloning of several genes responsible for rough eye, red, mosaic and white eye phenotypes of A. gambiae, as well as genes conferring organophosphate resistance. 2. Excellent genetic and physical mapping methods have now been developed for A. gambiae. High resolution molecular mapping approached the identification of regions of mosquito chromosomes which encode parasite refractory loci. 3. Several laboratories began work on the identification of candidate germ line transformation vectors. Promising results were obtained with transposable elements (mariner, hobo, hermes etc) which appear to be functional in mosquitos. Some progress was made on the analysis and transformation of insect symbionts and viruses for the introduction of antiparasitic genes into mosquitos. 4. Significant progress was made to establish the functionality of specific mosquito gene promoters. The blood meal inducible, gut-specific promoters derived from the A. gambiae trypsin genes were shown to induce expression of reporter genes in Drosophila gut cells, as well as in transfected excised mosquito gut cells and in mosquito cultured cells. 5. New data were obtained on the mosquito's cellular and humoral defence mechanisms against pathogenes and parasites. Mosquito homologues to cecropins, attacins, defencines and other antibacterial peptides were studied, as well as the process of encapsulation and melanization of invading parasites by refractory strains of mosquitos. It was shown that encapsulation trait depends on one or very few mosquito genes. A simple model for laboratory tests was developed on the base of negatively charged sephadex beads. 6. Theoretical computer models and laboratory experiments confirmed the hypothesis that novel genes loaded onto transposable elements could spread in mosquito populations. Field studies of genetic structure of the natural anopheline populations were initiated on malaria endemic territories, utilizing modern molecular techniques. These studies will provide new information on vector dynamics and on the potential problems and impact of releasing transgenic mosquitos into the environment. Possibilities for Collaboration in Workplan Activities Research proposals with budgets up to US$50,000 addressing one of the objectives mentioned above are invited. Projects are funded for three years after which investigators should reapply, either for a continuation or for a new line of research. At this point, competitive proposals are encouraged to assure continuation of particularly interesting research leads but the Committee will not fund parallel work at different institutions. Interested investigators should consult with the Committee manager before applying. How to apply Researchers interested in collaborating in the above mentioned activities should request application forms from the Communications department of TDR. All specific correspondence related to research covered by the Molecular Entomology Committee should be sent to Dr B. Dobrokhotov Manager of the Molecular Entomology Committee UNDP/World Bank/WHO Special Programme for Research and Training in Tropical Diseases (TDR) World Health Organization, 20 Avenue Appia, CH-1211 Geneva 27, Switzerland Tel: (41.22) 791.3816/3724 Fax: (41.22) 791.4854 Internet: DOBROKHOTOVB@WHO.CH -----------WorkPlan 1996 in list format follows-------------------- WORKPLAN FOR THE COMMITTEE ON MOLECULAR ENTOMOLOGY (BCV) FOR 1996-97 OBJECTIVES PLANNED ACTIVITIES ---STATUS 1. Molecular tools for genetic manipulation (a) Genome mapping of Anopheles gambiae - Integration of genetic and molecular chromosome maps - Cosmid and other contiguous libraries development - Target high resolution chromosome mapping ---In progress, entire genome microsatellite map completed (b) Development of selectable markers for transformation - Characterization of eye colour genes of A. gambiae for which the mutant alleles exists (especially white) ---In progress, gene cloned and available for screening - Testing new dominant selective genes of ACE and parathion resistance as markers ---In progress, other phenotypic markers may be available (c) Characterization of tissue specific promoters of Anopheles gambiae - Characterization of salivary gland specific promoters of A. gambiae and testing in Drosophila and by transient expression in Anopheles. - (ditto-midgut, fatbody, haemocytes) ---To be initiated in 1996 (d) Development of germ line transformation in Anopheles gambiae - Search for and characterization of inverted repeat transposable elements in mosquitoes other than A. gambiae ---In progress - Testing of transposable elements, such as Minos, Hobo and Mariner as gene vectors for transformation of A. gambiae ---Preliminary stage, good results with other insects - Studies of viral and bacterial symbionts as gene vectors ---In progress - Improvement of methods for introducing DNA into embryos ---In progress, promising results obtained (e) Preservation of Anopheles stocks Cryopreservation of embryos ---Preliminary stage (f) Databases Integrated databases for mosquitoes (genetic, chromosomal, bibliographic, etc.) ---To be initiated in collaboration with MacArthur Foundation 2. Molecular basis of vectorial capacity Genetic, molecular and physioethological studies of vector-parasite interactions ---In progress - Midgut targets for disruption of parasite growth and development: * Exflagellation factor characterization ---In progress * Chitinase studies in anopheline vectors ---Preliminary stage * Gut receptors ---In progress * Exogenous peptides or antibodies ---In progress - Hemolymph targets: * Immune and phenol oxidase recognition system ---In progress * Exogenous peptides ---Preliminary stage - Salivary gland targets * Surface receptors for sporozoite ---In progress * Exogenous peptides ---To be initiated 3. Population genetics (a) Population structure - Analysis of genetic polymorphism relevant to vectorial capacity ---In progress, many new markers available - Gene flow and mating barriers rates between Anopheles populations ---In progress, field studies in tropical countries (b) Gene driver systems - Efficiency evaluation of transposable elements ---In progress, laboratory studies - Evaluation of cytoplasmic incompatibility systems ---In progress and computer modelling 4. Olfaction systems (a) Identification of chemical signals involved in host finding by anopheline vectors Host volatiles, attractants and repellents: * Chemical analysis of effective compounds * Electrophysiological and behavioural tests ---In progress, outside TDR (b) Olfactory and contact chemosensory mechanisms Host selection, contact chemosensory cues and ethological studies: * Electrophysiological studies of effective components and mixtures on single receptor neurons ---In progress, mainly outside TDR * Laboratory and field studies on behavioural responses to host and non-host components and mixtures ---In progress (c) Molecular genetics of olfaction ---A few projects initiated 1995 (mol_ento.txt)vvb20mar96  From owner-vectors@net.bio.net Wed Mar 20 22:00:00 1996 Path: biosci!biosci!not-for-mail From: Dennis L. Knudson Newsgroups: bionet.biology.vectors Subject: TDR WorkPlan96: FILARIASIS (fwd) Date: 21 Mar 1996 05:59:36 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 291 Sender: daemon@net.bio.net Approved: vbmod@klab.agsci.colostate.edu Distribution: world Message-ID: <4irnc8$7v9@net.bio.net> NNTP-Posting-Host: net.bio.net Forwarded with permission of listeserver manager. ---------- Forwarded message ---------- Date: Wed, 20 Mar 96 18:11:16 CET From: hatak@who.ch To: TDR-Scientists@who.ch, ramachandranc@who.ch Cc: agbayanim@who.ch Subject: TDR WorkPlan96: FILARIASIS UNDP/World Bank/WHO Special Programme for Research and Training in Tropical Diseases (TDR) WORKPLAN of the TASK FORCE on OPERATIONAL RESEARCH IN FILARIASIS Rationale The activities of the Task Force on Operational Research in Filariasis will emphasize operational research needs in the area of lymphatic filariasis. The major challenge facing the Task Force is to consolidate available new research findings based on current and planned activities and translate them into affordable, cost-effective and sustainable strategies. The Task Force recognizes that recent developments in the area of understanding the pathogenesis and identification of hidden pathology as well as development of chemotherapy strategies now place lymphatic filariasis among the list of potentially "eradicable" diseases. In order to develop the control strategies to achieve this aim the Task Force has identified 5 major thrust areas: Objectives An outline of the objectives, strategies and ongoing and planned activities of the Task Force on Operational Research in Filariasis is given below. (1) Development of rapid assessment methods for epidemiological mapping of infection and disease; (2) Assessment of chemotherapy delivery strategies by supporting studies that will help in programme design and evaluation and studies that will assess the cost and sustainability of delivery strategies; (3) To promote chemotherapy product development especially DEC-fortified salt; (4) To evaluate the role of supplementary interventions such as vector control and morbidity management in control programmes; and lastly, (5) To estimate the global clinical and socioeconomic burden of the illness which will be utilized to enhance the advocacy of the control programme. Strategies (1) Carry out studies to develop and evaluate rapid assessment procedures to determine the prevalence of the disease in the community and infective stages in the vectors and assess the cost-effectiveness of these approaches; (2) Carry out studies to assess the community acceptance, cost-effectiveness and impact and process of different delivery strategies with particular emphasis on annual community chemotherapy and DEC-fortified salt; (3) To evaluate safety and efficacy of newer drug and combinations in comparisons with DEC; to assess the safety, efficacy and delivery of iodized DEC salt and ivermectin in endemic areas and also in areas where mixed infections occur. (4) To assess the cost-effectiveness of vector control and morbidity management in the control of lymphatic filariasis; (5) To estimate the geographical extent, patterns and socioeconomic impact of the disease and promote studies to highlight the gender differences and the impact and? extent and accessibility of sub-clinical lymphangiopathy. Activities (1) Phase III and Phase IV studies using ivermectin and DEC tablets and combinations or DEC-medicated salt and vector control, where appropriate, including studies with Bacillus sphaericus, polystyrene beads and improvement of sanitation. (2) Studies to determine the effect of ivermectin and DEC individually or in combination as well as antibiotics in preventing lymphoedema and acute filarial attacks and early chronic disease in asymptomatic and symptomatic individuals. (3) Studies to determine the potential macrofilaricidal effects of ivermectin and other drugs. (4) Studies to determine the microfilaricidal and macrofilaricidal effects of ivermectin and DEC (or albendazole) given together. (5) Studies to determine the potential of DEC-medicated salt for prophylaxis and prevention of acute attacks. (6) Field evaluation of antigen detection assays and DNA-probes for detection of infection in communities and vectors and for monitoring recrudescence. (7) Essential studies to describe specific aspects of the dynamics of filarial infections and consequent pathogenesis. (8) Use of existing data from various endemic areas to estimate quantitative relationships among host, pathogen and vector and to develop analytic and simulation models for lymphatic epidemiology and control. (9) Comparative analyses of the costs and effectiveness of different control strategies under different conditions. (10) Studies of the reliability and validity of rapid assessment procedures. (11) Develop surveillance techniques that will permit reliable estimates of incidence and prevalence of filarial infection and disease, the public health impact and trend over time, including the global health burden of lymphatic filariasis. (12) Assessment of socio-economic burden of disease. How to apply Researchers interested in proposals for 1996 should be submitted by 30 July for consideration at the September 1996 Task Force meeting. Correspondence should be addressed to: Manager Task Force on Operational Research in Filariasis Special Programme for Research and Training in Tropical Diseases (TDR), World Health Organization 1211 Geneva 27, Switzerland Fax: (41-22) 791-4854 ------------------WorkPlan96 in list format follows--------------------- W O R K P L A N Major thrusts Specific activities ----Status I. RAPID ASSESSMENT METHODS 1. Rapid epidemiological mapping of infection and disease. (a) Evaluation of rapid sampling methods in the community. ----(a) One study funded in Ghana. Commission research in areas already mapped. Ongoing 2. Assessment of transmission levels to guide control design. (a) Detection of infective stages in vectors. ----(a) Evaluation studies funded in Papua New Guinea, India and Tahiti. (b) Antigen detection of infection in communities. ----(b) Evaluation studies funded in Tahiti and Papua New Guinea. II. CHEMOTHERAPY DELIVERY STRATEGIES 1. Support for programme design and evaluation. (a) Development and assessment of biomathematical modelling methods. ----(a) Study ongoing. Evaluation of approach to be undertaken. 2. Cost and sustainability of delivery strategies. (a) Assessment of community acceptance of different delivery strategies. ----(a) Study in India. Further studies being developed. (b) Impact and process of annual community chemotherapy. ----(b) Studies ongoing in India, Papua New Guinea, Tahiti. (c) Impact, process and delivery of DEC-fortified salt. ----(c) Study ongoing in India. One further study to be developed. (d) CEA of chemotherapy strategies ----(d) Component of all community studies. III. CHEMOTHERAPY PRODUCT DEVELOPMENT 1. Annual chemotherapy (a) Standardization of DEC dose for community application. ----(a) Completed. (b) Comparison of new products with DEC. ----(b) Ongoing for: IVR, IVR & DEC, Albendazole. Phase I studies to be planned for Amocarzine. (c) Assessment of safety of IVR use in loaisis endemic areas. ----(c) Study funded in Cameroon. 2. DEC-fortified salt. (a) Safety and efficacy of delivery of DEC in iodinised salt. ----(a) Study aproved. (b) Safety of delivery of fortified salt in onchocerciasis and loaiasis endemic areas. ----(b) Study to be developed. IV. SUPPORTIVE INTERVENTIONS 1. Supplementary vector control (a) Effectiveness and logistics of vector control methods. ----(a) Largely completed. Recommend the Bed Net Task Force to evaluate effects against filariasis. (b) Costs and CEA of vector control methods. ----(b) One funded in India. Further studies required, including Biocide projects already completed. Review paper to be commissioned. 2. Morbidity management (a) Efficacy of antibiotics, antifungals and hygienic practices. ----(a) Four studies in India. (b) Efficacy of individual chemotherapy. ----(b) Two studies in India. (c) CEA of morbidity management. ----(c) Component of all studies. V. GLOBAL BURDEN OF FILARIASIS 1. Quantification of current burden. (a) Estimation of geographical extent and patterns of disease. ----(a) Study to be developed. (b) Socioeconomic impact of disease. ----(b) Six studies on indirect costs: India, Africa and the Philippines. Study required on direct health costs. 2. Estimation of hidden disease. (a) Disease in women. ----(a) Two studies in India. Further studies to be developed. (b) Impact, extent and reversibility of sub-clinical lymphangiopathy. ----(b) One study in Brazil. Further studies to be developed. (filarias.txt)vbb.20mar96  From owner-vectors@net.bio.net Sun Mar 24 22:00:00 1996 Path: biosci!biosci!not-for-mail From: graciela panzetta Newsgroups: bionet.biology.vectors Subject: PCR Aedes Date: 25 Mar 1996 12:07:22 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 18 Sender: daemon@net.bio.net Approved: vbmod@klab.agsci.colostate.edu Distribution: world Message-ID: <4j6udq$8nj@net.bio.net> NNTP-Posting-Host: net.bio.net To whom may concern Hello! I'm very pleased to join the VECTOR-BIOLOGY newsgroup. I'm a molecular biologist working in colaboration with Dra. Gardenal in Aedes albifasciatus population genetics. We are looking forward to amplify mtDNA of Aedes albifasciatus with the following primers TL2-J-3037 (alias A-t-LEU): ATGGCAGATTAGTGCAATGG C3-N-5460 (alias CO 3b): TCAACAAGTGTCAGTATCA We should like to know if these primers have already been used in these genera? Otherwise, is there other pair of primers suitable for mtDNA PCR/RFLP? THANKS IN ADVANCE FOR YOUR HELP! From owner-vectors@net.bio.net Mon Mar 25 22:00:00 1996 Path: biosci!biosci!not-for-mail From: Nicholson, William Newsgroups: bionet.biology.vectors Subject: tick rearing Date: 26 Mar 1996 07:55:52 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 40 Sender: daemon@net.bio.net Approved: vbmod@klab.agsci.colostate.edu Distribution: world Message-ID: <4j9428$c1r@net.bio.net> NNTP-Posting-Host: net.bio.net Dear Asa Gylfe, Umea University, Sweden: In reply to your request for tick rearing procedures, you may want to refer to the book, Biology of Ticks, Volume 2, by D. E. Sonenshine. It was published in 1993 by Oxford University Press in New York, NY. The appendix (pp. 372-412) describes methods for the rearing of ticks in the laboratory. In our tick colony we use small glass vials with fine-mesh cloth to hold ticks. The base of the vials are filled with a solid mix of plaster of paris/activated charcoal. This surface can be moistened to provide a humid environment for the ticks, and the charcoal supposedly provides some mold retardation. The vials are held in a dessicator chamber with either plain water or saturated salt solution in the bottom to maintain humidity. These chambers are then placed into a refrigerated incubator or environmental chamber. We set the temperature just a bit below room temperature (21C). These lower temperatures are suitable for maintaining unfed stages for long periods of time. You may wish to increase the temperature for greater and more rapid (as ticks go) productivity. Mold is a continual enemy. By autoclaving the vials, you can provide a clean environment when the ticks are placed inside. Ticks removed from animals can be washed with tap water to remove adherent serous exudate which can serve as a growth medium for bacteria and fungi. We were able to surface clean unfed ticks with dilute disinfectants, but this proved detrimental to engorged ticks. Weekly checks of all vials helps to identify mold attack, and these vials can be discarded. Periodically moving ticks into new vials was also useful in keeping the mold problems to a minimum. I can provide further information on tick rearing if you can send me your e-mail address. Good luck. William L. Nicholson wan6@ciddvd1.em.cdc.gov tel: (404) 639-1075 fax: (404) 639-4436 ---------- From owner-vectors@net.bio.net Tue Mar 26 22:00:00 1996 Path: biosci!biosci!not-for-mail From: Reuben Kaufman Newsgroups: bionet.biology.vectors Subject: Re: tick rearing Date: 27 Mar 1996 08:41:32 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 76 Sender: daemon@net.bio.net Approved: vbmod@klab.agsci.colostate.edu Distribution: world Message-ID: <4jbr3s$1vc@net.bio.net> NNTP-Posting-Host: net.bio.net Subject: Time: 11:33 OFFICE MEMO re> tick rearing Date: 26/03/1996 In response to this request, let me caution that in my experience (lab rearing of Amblyomma hebraeum, an African tick), it is inadvisable to wash ticks in order to prevent mould; quite the contrary, I almost lost my colony to mould when I did so on a large batch which had been left too long after moulting. It is important to change the vials and filter paper substrate at least once within a week of moulting and perhaps once again a few weeks later so that the ticks do not become encrusted in fecal material, but don't wash the ticks. I suspect this is because the surface of the cuticle has a bacteriostatic/fungostatic secretion, although I've never tested this (perhaps others have?). Bill Nicholson's experience with washing ticks is obviously different from mine, so perhaps one should do the obvious tests with a few samples before subjecting the whole colony to risk. It's also important to avoid overcrowding. Broad flat containers are better than narrow tall ones. When we use vials to store nymphs, we never fill them to more than 25% of the volume. Best of luck! _______________________________________________ Reuben Kaufman Department of Biological Sciences University of Alberta, Edmonton, Canada T6G 2E9. E-mail: Reuben_Kaufman@biology.ualberta.ca Fax: + (403) 492-9234 Phone: (403) 492-1279 -------------------------------------- Date: 26/03/1996 09:05 To: Reuben Kaufman From: Nicholson@net.bio.net Dear Asa Gylfe, Umea University, Sweden: In reply to your request for tick rearing procedures, you may want to refer to the book, Biology of Ticks, Volume 2, by D. E. Sonenshine. It was published in 1993 by Oxford University Press in New York, NY. The appendix (pp. 372-412) describes methods for the rearing of ticks in the laboratory. In our tick colony we use small glass vials with fine-mesh cloth to hold ticks. The base of the vials are filled with a solid mix of plaster of paris/activated charcoal. This surface can be moistened to provide a humid environment for the ticks, and the charcoal supposedly provides some mold retardation. The vials are held in a dessicator chamber with either plain water or saturated salt solution in the bottom to maintain humidity. These chambers are then placed into a refrigerated incubator or environmental chamber. We set the temperature just a bit below room temperature (21C). These lower temperatures are suitable for maintaining unfed stages for long periods of time. You may wish to increase the temperature for greater and more rapid (as ticks go) productivity. Mold is a continual enemy. By autoclaving the vials, you can provide a clean environment when the ticks are placed inside. Ticks removed from animals can be washed with tap water to remove adherent serous exudate which can serve as a growth medium for bacteria and fungi. We were able to surface clean unfed ticks with dilute disinfectants, but this proved detrimental to engorged ticks. Weekly checks of all vials helps to identify mold attack, and these vials can be discarded. Periodically moving ticks into new vials was also useful in keeping the mold problems to a minimum. I can provide further information on tick rearing if you can send me your e-mail address. Good luck. William L. Nicholson wan6@ciddvd1.em.cdc.gov tel: (404) 639-1075 fax: (404) 639-4436 From owner-vectors@net.bio.net Tue Mar 26 22:00:00 1996 Path: biosci!biosci!not-for-mail From: D.L. Knudson Newsgroups: bionet.biology.vectors Subject: Mosquito Databases Date: 27 Mar 1996 12:44:47 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 45 Sender: daemon@net.bio.net Approved: vbmod@klab.agsci.colostate.edu Distribution: world Message-ID: <4jc9bv$ouh@net.bio.net> NNTP-Posting-Host: net.bio.net We announce the formation of the Mosquito Genomics Database (MsqDB) at URL http://klab.agsci.colostate.edu/. The purpose of this database is to collate both the genetic and physical chromosome mapping data across mosquito species. The information therein is made available to the Internet community through the World Wide Web (WWW). Please remember that this a work in progress and the WWW interface will always provide access to the most recent MsqDB. Presently, MsqDB has 49,995 references of which some >35,000+ come from the MODABUND (Mosquito Database University of Notre Dame) project. Modabund was compiled by R.A. Hellenthal and T. J. Crovello in the early 1970's at the University of Notre Dame. Since then it had been in the care of S.Hanson and G. B. Craig, who kindly provided it electronically for inclusion in this Mosquito database. The original reference for the database is Reference Title MODABUND-THE COMPUTERIZED MOSQUITO DATA BANK AT UNIVERSITY OF NOTRE DAME. Journal Mosquito News Page 548 554 Volume 32 Number 4 Year 1972 Author Crovello, T. J. We have installed these items in MsqDB and assigned new updated keywords for searching etc. This effort of reformatting and installing etc was done by one of the curators, Martin Ferguson. Besides those involved with MODADUND, our thanks to one of our curators Leonard Munstermann who kindly suggested installing the MODABUND references. In addition, we have made a number of changes in our interface to MsqDB and AaeDB. Enjoy! at URL http://klab.agsci.colostate.edu/ -- =*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*= Dr. Dennis L. Knudson, Professor of Entomology and Microbiology Department of Entomology Telephone: 970 491-7255 College of Agricultural Sciences Fax: 970 491-0564 Colorado State University Internet:dknudson@lamar.colostate.edu Fort Collins, CO 80523 USA URL http://klab.agsci.colostate.edu/ =*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*= From owner-vectors@net.bio.net Wed Mar 27 22:00:00 1996 Path: biosci!biosci!not-for-mail From: BIOSCI Administrator Newsgroups: bionet.biology.vectors Subject: IMPORTANT - BIOSCI Fundraising Update! Date: 28 Mar 1996 05:34:35 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 150 Sender: daemon@net.bio.net Approved: vbmod@klab.agsci.colostate.edu Distribution: world Message-ID: <4je4hb$4e1@net.bio.net> NNTP-Posting-Host: net.bio.net I'm interrupting the usual monthly posting of the BIOSCI miniFAQ to bring you up to date on BIOSCI fundraising progress, a topic of concern to your future use of this resource. Thank you in advance for taking the time to read this message carefully. Last year we announced that BIOSCI was going to adopt the U.S. Public Broadcasting System model to fund its operations after our DOE/NSF grant runs out later this year. Unlike PBS, we are not soliciting contributions from users; we are only selling ads on our Web pages solely to cover our operating costs. Our goal is to seek sponsorships until we build up an operating reserve of about $100,000 and then cease further promotions until we need to build the reserve back up. (The accountants among our readership will be familiar with the problem of deferred revenue which we can not safely utilize until ads have been displayed for a period of time.) We have three sponsors to date with a couple more pending. The process is time-consuming, however, and we need your help as explained further below. Our operating costs consist of our network connection, phone lines, hardware maintenance (we hope to have new and faster hardware soon!), plus 0.7 FTE of salaries covering UNIX systems admin, technical support, quality assurance, i.e., testing, of our system, and administrative costs (such as the time it takes to actually find/write/call potential sponsors and raise money!). Although the BIOSCI staff does get compensated for a portion of the work that they do, this project has always received a lot of free after-hours and "vacation" time labor, so we hope that no one will begrudge the time that we do charge to the project to serve you. All of the three part-time staff members, Dave Mack, Julie Lawrence, and myself, have full time day jobs and families in addition to working hard to keep this service running for all of you. Julie and Dave Mack are subcontractors for BIOSCI; my time that is charged to the project defrays a portion of my regular salary instead of adding to my income. Besides having to relocate the project, we were very busy this last year building new infrastructure such as our WWW hypermail interface to the system. This was released last December along with scores of WAIS indices for the newsgroups. Virtually everything is complete, although we do continue to find and fix bugs (many through your helpful feedback!). We are still having some problems with our WAIS indexing. The archives continue to grow rapidly. We are running over 100 indexes now versus three previously and any systems crashes cause greater havoc with the indexing than before! We are still working to fix this as fast as our resources permit and appreciate your patience, but we have been able to automate a lot of the infrastructure to reduce labor as compared to past requirements. We have also implemented new software to make moderation of BIOSCI/bionet newsgroups much easier and combat the growing problem of Internet junk mail and USENET "spamming." About 20% of our groups are now moderated, many of them by the BIOSCI staff! This, for example, made a major difference last year in the quality of content in our EMPLOYMENT/bionet.jobs.offered newsgroup which many commercial concerns and recruiting firms are using **without charge** to recruit candidates for positions in the biological sciences. We are also now in a position to have sponsors for individual newsgroups as you will have noticed if you have visited http://www.bio.net/ and clicked on "Access the BIOSCI/bionet newsgroups" recently. So, how can you help?? ---------------------- As noted above it can take a lot of time to contact potential sponsors if I have to do it all myself. Our request is quite simple. You can do two important things which will take very little time for you individually. First, please use our WWW system at http://www.bio.net/ to access the archives. You can now post or reply to messages via your Web browser. Your usage helps attract sponsors. If you contact any of our sponsors, please be sure to thank them for supporting BIOSCI. It is critical for them to get this feedback if they are to continue their sponsorship for the long term. Second, if you work for a company or organization that provides products or services of interest to the biology community, please pass this message on to your marketing or marketing communications department or other appropriate group. Please ask them to help support BIOSCI by sponsoring our Web site and explain the uses and benefits of the system to the biology community. If they are interested, they can then contact us for further information at our tech support address, biosci-help@net.bio.net. Our hope is to quickly raise several large corporate/institutional sponsors on our heavily-used WWW locations (some stats appended below), and then end this sponsorship campaign so that our resources can continue to be used for service provision, not fundraising. Many of our specialty newsgroup WWW archives are still used by small communities of scientists (and they haven't been heavily promoted yet). While these may be valuable niche markets to some advertisers, it will generate more labor and overhead having to find these sponsors, fairly price the locations, and deal with lots of smaller sponsorships than fewer mid-to large sponsors. We are striving to keep our operation as lean and efficient as possible since we are not trying to make careers out of running BIOSCI. We are trying if at all possible to avoid the administrative overhead entailed with processing lots of small payments to reach our fundraising goals. I'd like to thank all of you for your help in advance. In helping us, you are also helping yourselves, not only in keeping this resource available for all of the both large and small research communities that we serve, but also by alleviating the need for us to go back and compete with researchers for tight grant dollars! We promised NSF when we were awarded the BIOSCI grant that we would carry out this mission to make the service self-supporting. With your help, we will succeed in continuing BIOSCI's work into its second decade. Thank you very much! Sincerely, Dave Kristofferson BIOSCI/bionet Manager biosci-help@net.bio.net A list of our prime WWW sponsorship locations follow. Statistics are for the four week period from 22 Jan. - 18 Feb. 1996 and usage continues to grow. ---------------------------------------------------------------------- The overall BIOSCI WWW pages are currently visited by users from close to 5000 unique computer hosts per week. Web servers only log the Internet computer/host name and frequently more than one individual can connect to us from a particular host. Main home page, http://www.bio.net, visited recently by about 2100 unique hosts per week Main Newsgroups archives page, http://www.bio.net/archives.html, visited recently by about 1200 Unique hosts per week BIO-JOURNALS archive page, http://www.bio.net/BIO-JOURNALS.html, visited recently by about 1000 unique hosts per week. EMPLOYMENT archive pages: http://www.bio.net:80/hypermail/EMPLOYMENT/ and monthly header pages, visited recently by about 600 unique hosts per week. Address database search page, http://www.bio.net/addrsearch.html, visited recently by about 450 unique hosts per week. Methods newsgroup archive pages, http://www.bio.net:80/hypermail/METHDS- REAGNTS/ and monthly header pages, visited recently by about 350 unique hosts per week. ---------------------------------------------------------------------- From owner-vectors@net.bio.net Wed Mar 27 22:00:00 1996 Path: biosci!biosci!not-for-mail From: Nicholson, William Newsgroups: bionet.biology.vectors Subject: Tick rearing (3) Date: 28 Mar 1996 05:33:49 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 24 Sender: daemon@net.bio.net Approved: vbmod@klab.agsci.colostate.edu Distribution: world Message-ID: <4je4ft$49d@net.bio.net> NNTP-Posting-Host: net.bio.net I'm sorry if my original message was unclear. I do not routinely wash colony ticks with water or with disinfectants to remove mold. This has been used only as a last resort for individual vials due to the unpredictable results in viability. Additionally, field-collected ticks are washed with water only if heavily encrusted with dirt and serous exudate when mechanically removed from an animal host. They are then placed on paper toweling to wick the moisture away before placing them into the vials. In normal colony feedings, the ticks are allowed to drop from the host into a pan of water. Thus, no intentional washing occurs, although they are floating in water prior to being retrieved. We harvest the ticks from the pan and place them on clean paper toweling to wick away the wetness. They are then transferred to autoclaved vials and placed into the incubator. Upon molting, the ticks are transferred into a new vial because the shed cuticles can facilitate mold growth. As Dr. Kaufman pointed out, and I stated in the original posting, the most important procedure is to monitor the vials carefully, and change vials as needed to keep mold to a minimum. William L. Nicholson wan6@ciddvd1.em.cdc.gov Tel: (404) 639-1075 Fax: (404) 639-4436 From owner-vectors@net.bio.net Wed Mar 27 22:00:00 1996 Path: biosci!biosci!not-for-mail From: Dennis L. Knudson Newsgroups: bionet.biology.vectors Subject: TDR AFR: Investigator-Initiated Projects Date: 28 Mar 1996 13:16:07 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 104 Sender: daemon@net.bio.net Approved: vbmod@klab.agsci.colostate.edu Distribution: world Message-ID: <4jevin$rh6@net.bio.net> NNTP-Posting-Host: net.bio.net ------------- Begin Forwarded Message ------------- From owner-tdr-scientists@sun1.who.ch Thu Mar 28 12:41 MST 1996 Date: Thu, 28 Mar 96 18:46:21 CET From: hatak@who.ch To: TDR-Scientists@who.ch, remmej@who.ch Subject: TDR AFR: Investigator-Initiated Projects re investigator-initiated projects in applied field research (AFR) ----------------------------------- March 1996 UNDP/World Bank/WHO Special Programme for Research and Training in Tropical Diseases (TDR) Assistance to Investigators in preparing proposals for applied field research in tropical diseases The TDR Steering Committee on Applied Field Research reviews during its annual meeting new proposals for investigator-initiated research projects on applied field research in tropical diseases. Many of the proposals which have been submitted in recent years by investigators from disease endemic countries, addressed important research issues for tropical disease control. Unfortunately, these proposals were often not adequately developed and presented, and many worthwhile ideas were not funded. The Steering Committee, therefore, is offering to provide assistance with proposal development to interested researchers who have important ideas for applied field research on priority issues for tropical disease control. The research priorities for this initiative have been identified by the WHO Division for Control of Tropical Diseases, and they are the following: Epidemiological surveillance of tropical diseases and detection of epidemics Management, decision-making and information systems in tropical disease control Cost-effective interventions against mosquito vectors of tropical diseases in the urban environment The Steering Committee proposes the following initiative for 1996: Investigators interested in undertaking applied field research on one of the priority topics listed above, and who would like to benefit from the assistance of Steering Committee members in developing a full research proposal, should submit a letter-of-intent to TDR . The Steering Committee will review the letters-of-intent and select those which it considers sufficiently promising for further development. Individual members of the Committee will assist the selected investigators by correspondence with the development of a full research proposal. The final proposals should be submitted to TDR before December 1996 for review by the Steering Committee during its next meeting. The letter-of-intent should be in English or French and include a short outline of 2 pages of the rationale, objectives and design of the proposed study. It should also include abbreviated Curriculum Vitae of one page maximum for the principal investigator and the main co-investigators. At this stage it is not necessary to include budget estimates. The initiative is open only to investigators who are nationals from a disease endemic country. ---------------------------------------- Letters of intent should be addressed to: Dr J.H.F. Remme, Manager, Steering Committee on Applied Field Research, TDR, World Health Organization, 1211 Geneva 27, Switzerland Tel.: 41-22-791.38.15; Fax: 41-22-791-4854; Internet: RemmeJ@WHO.CH The letters of intent should reach Geneva no later than 15 June 1996. ------------ Please note that letters-of-intent and research proposals, sent by regular mail from disease endemic countries, often arrive too late in Geneva to be reviewed by the Steering Committee. Consider sending your letter-of-intent by Fax, E-mail or another fast and reliable route to ensure timely arrival in Geneva. (afrin96a.txt)vbb.26mar96  ------------- End Forwarded Message ------------- From owner-vectors@net.bio.net Fri Mar 29 22:00:00 1996 Path: biosci!biosci!not-for-mail From: hatak@who.ch Newsgroups: bionet.biology.vectors Subject: TDR AFR: Investigator-Initiated Projects Date: 30 Mar 1996 05:18:33 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 97 Sender: daemon@net.bio.net Approved: vbmod@klab.agsci.colostate.edu Distribution: world Message-ID: <4jjcb9$p8e@net.bio.net> NNTP-Posting-Host: net.bio.net re investigator-initiated projects in applied field research (AFR) ----------------------------------- March 1996 UNDP/World Bank/WHO Special Programme for Research and Training in Tropical Diseases (TDR) Assistance to Investigators in preparing proposals for applied field research in tropical diseases The TDR Steering Committee on Applied Field Research reviews during its annual meeting new proposals for investigator-initiated research projects on applied field research in tropical diseases. Many of the proposals which have been submitted in recent years by investigators from disease endemic countries, addressed important research issues for tropical disease control. Unfortunately, these proposals were often not adequately developed and presented, and many worthwhile ideas were not funded. The Steering Committee, therefore, is offering to provide assistance with proposal development to interested researchers who have important ideas for applied field research on priority issues for tropical disease control. The research priorities for this initiative have been identified by the WHO Division for Control of Tropical Diseases, and they are the following: Epidemiological surveillance of tropical diseases and detection of epidemics Management, decision-making and information systems in tropical disease control Cost-effective interventions against mosquito vectors of tropical diseases in the urban environment The Steering Committee proposes the following initiative for 1996: Investigators interested in undertaking applied field research on one of the priority topics listed above, and who would like to benefit from the assistance of Steering Committee members in developing a full research proposal, should submit a letter-of-intent to TDR . The Steering Committee will review the letters-of-intent and select those which it considers sufficiently promising for further development. Individual members of the Committee will assist the selected investigators by correspondence with the development of a full research proposal. The final proposals should be submitted to TDR before December 1996 for review by the Steering Committee during its next meeting. The letter-of-intent should be in English or French and include a short outline of 2 pages of the rationale, objectives and design of the proposed study. It should also include abbreviated Curriculum Vitae of one page maximum for the principal investigator and the main co-investigators. At this stage it is not necessary to include budget estimates. The initiative is open only to investigators who are nationals from a disease endemic country. ---------------------------------------- Letters of intent should be addressed to: Dr J.H.F. Remme, Manager, Steering Committee on Applied Field Research, TDR, World Health Organization, 1211 Geneva 27, Switzerland Tel.: 41-22-791.38.15; Fax: 41-22-791-4854; Internet: RemmeJ@WHO.CH The letters of intent should reach Geneva no later than 15 June 1996. ------------ Please note that letters-of-intent and research proposals, sent by regular mail from disease endemic countries, often arrive too late in Geneva to be reviewed by the Steering Committee. Consider sending your letter-of-intent by Fax, E-mail or another fast and reliable route to ensure timely arrival in Geneva. (afrin96a.txt)vbb.26mar96  ------------- End Forwarded Message ------------- From owner-vectors@net.bio.net Sun Mar 31 23:00:00 1996 Path: biosci!biosci!not-for-mail From: David M. Sander Newsgroups: bionet.biology.vectors Subject: All the Virology on the WWW - Updates Date: 1 Apr 1996 06:34:14 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 136 Sender: daemon@net.bio.net Approved: vbmod@klab.agsci.colostate.edu Distribution: world Message-ID: <4joph6$aa7@net.bio.net> NNTP-Posting-Host: net.bio.net Dear Fellow WWW user, The Garry Lab is pleased to announce a major update of our well known WWW site, All the Virology on the WWW: http://www.tulane.edu/~dmsander/garryfavweb.html In addition to listing all the virology related sites on the www, this resource now includes The Big Picture Book of Viruses and a collection of online microbiology and virology courses and tutorials. The Big Picture Book of Viruses displays viruses by family in photographs and graphics from sites around the web. It includes direct links to other sites of interest for each virus as well as links to tutorials. The online courses are courtesy of Dr. Alan Cann of the University of Leicester, UK. We thank him for his support! Many other resources on the page have been updated, and a table of contents is attached below. If you would like to add your site to our list, please use the submission form at the following URL: http://www.tulane.edu/~dmsander/garryfavwebadd.html I look forward to hearing any and all comments or suggestions that you may have. Thanks again for your support. Sincerely, David M. Sander -------------------------------------------------------------------------------- A L L T H E V I R O L O G Y O N T H E W W W : T A B L E O F C O N T E N T S Institutional Virology Servers Virology Departments, and Research Institutes Virology Labs within Institutions Anti-Viral Drug Resources Vaccine and Vaccine Development Sites General Virology Resources and Databases Infectious Disease Resources Virological Laboratory Techniques Viral Electron Micrographs & Macromolecular Images Taxonomy and Phylogeny of Viruses Viral Genome Sequence Data Graduate Programs in Virology On-Line Virology Courses and Tutorials Institutional Microbiology Servers Plant Virus Servers and Information Specific Virus Servers and Information Adenoviruses Animal Viruses - Bovine, Equine, etc. Arboviruses - Insect (arthropod-borne) Viruses, Flockhouse Astroviruses - Gastroenteritis Bunyaviridae - Hantavirus Caliciviridae Coronaviridae Filoviridae - Ebola Flaviviridae- Hepatitis C Viruses Herpesviridae -- Herpesviruses Cytomegalovirus - CMV Epstein Barr Virus - EBV Norwalk Viruses - Gastroenteritis Viruses Astroviridae Caliciviridae Orthomyxoviridae - Influenza Viruses Paramyxoviridae Paramyxoviruses - Para-Influenza Viruses Morbilliviruses - Measles Viruses Papovaviridae - Papillomaviruses Parvoviridae Picornaviridae Apthoviridae - Foot-and-Mouth Disease Viruses Enteroviridae - Polio Viruses Rhinoviridae - Rhinoviruses Poxviridae Retroviridae - Retroviruses A-Type Retroviruses - HIAP (Human Intracisternal Particles) Immunodeficiency Viruses - HIV-1, HIV-2 (See AIDS info also) Leukemia Viruses - FeLV Reoviridae - Reoviruses Rhabdoviruses - Rabies Viruses Togaviridae Rubiviridae- Rubella Viruses More Internet Resources for Virologists: AIDS Information/Research (See HIV info also) General AIDS Information Misc. Special Topic AIDS Servers Clinical AIDS and Patient Care Resources Clinical Trials Information Educational/Sociological AIDS Resources Legal Issues Surrounding AIDS Other Lists of WWW AIDS Sites Alternative Views of AIDS Usenet Newsgroups Related to AIDS Emerging Viruses Information/Research Other Health Organizations Disease Servers (Viral?) Epidemiology and Public Health Sites Scientific Companies Scientific Societies of Interest to Virologists Online Access to Journals of Interest to Virologists Government Agencies of Interest to Virologists Patents & Legal Resources Technology Transfer Post-Doctoral and Other Science Jobs Microbiology and Virology Meetings Other Lists of WWW Links for Virologists Usenet Newsgroups for Virologists WWW Searching Options =========================================================================== David M. Sander E-Mail: dmsander@mailhost.tcs.tulane.edu Department of Microbiology and Immunology, SL38 Tulane University Medical School Phone:(504) 586-3818 (lab) 1430 Tulane Avenue 588-5150 (dept) New Orleans, LA 70112-2699 Fax: (504) 588-5144 (dept) WWW Homepage Address: http://www.tulane.edu/~dmsander/GarryHomePage.html All the Virology: http://www.tulane.edu/~dmsander/garryfavweb.html =========================================================================== There are two kinds of people, those who do the work, and those who take the credit. Try to be in the first group; there is less competition there. Indira Gandhi